AT3G24068

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0017508
Physical Location & Seq
Reverse (-)
8692191 .. 8692676
486 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G24068.1

Sequence Viewer

Length: 402 bp
ATGATATCCACCAAAGCATATAGCCTCTTCCTGGTCTCCTTAGCCTTAACGACCTCTTGGTTATCTTTGGCGGCTCCAGTCTTCACCATAAAGATAAGCAACAACCTTGCACCTGGCTCTAATCCGATCTCCATAAGTTGCATCTCGCCACAAAAAGATATTTGGTCTGCTGTTGTATCTCAAGGTCAGAGTTCCGAGTTTGGGTTTGACACAAACCGATCAGTTAAATGGACTTGTGACATCTCATCGGGAGCAAGAAAGAGTAGTTTCGTCATCTTTGATCTTAATAGAGACAAATCAAGATGCAGATCCGATGGTTTTTGTCTATGGCAAATCAATCCTGATGGTCTTTACCTATATGTCGCTTCTATTCAGAAATACCAAAAGCAATTCAATTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

133

Amino Acids

14.86

Weight (kDa)

9.18

Isoelectric Point (pI)

40.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 29 - 133 5.7e-20 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017508)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G24065 AT3G24068
prunus_persica Prupe.1G060200_v2.0.a1
pyrus_communis pycom16g19650
rosa_chinensis RchiOBHm_Chr4g0396871
rosa_laevigata RLG00000009498
rosa_rugosa Rorug03G0346800
rosa_samantha Rh4AG074200 Rh4BG070900 Rh4CG079000 Rh4DG068200
rosa_wichuraiana Rw4G005970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 71
AclWI GGATC 1 cut(s) 303
AfiI CCNNNNNNNGG 2 cut(s) 31, 201
AgsI TTSAA 1 cut(s) 394
AjnI CCWGG 2 cut(s) 30, 112
Alw26I GTCTC 2 cut(s) 40, 285
AlwI GGATC 1 cut(s) 303
AsuHPI GGTGA 1 cut(s) 76
BbsI GAAGAC 1 cut(s) 73
BccI CCATC 2 cut(s) 308, 338
BciT130I CCWGG 2 cut(s) 32, 114
BcoDI GTCTC 2 cut(s) 40, 285
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
Bme1390I CCNGG 2 cut(s) 32, 114
BmiI GGNNCC 1 cut(s) 75
BmrFI CCNGG 2 cut(s) 32, 114
BmsI GCATC 2 cut(s) 150, 293
BpiI GAAGAC 1 cut(s) 73
BpmI CTGGAG 1 cut(s) 60
Bpu10I CCTNAGC 1 cut(s) 40
BpuEI CTTGAG 1 cut(s) 165
BsaBI GATNNNNATC 1 cut(s) 307
BsaI GGTCTC 1 cut(s) 40
Bsc4I CCNNNNNNNGG 2 cut(s) 31, 201
Bse1I ACTGG 1 cut(s) 77
Bse8I GATNNNNATC 1 cut(s) 307
BseBI CCWGG 2 cut(s) 32, 114
BseJI GATNNNNATC 1 cut(s) 307
BseLI CCNNNNNNNGG 2 cut(s) 31, 201
BseNI ACTGG 1 cut(s) 77
BslI CCNNNNNNNGG 2 cut(s) 31, 201
BsmAI GTCTC 2 cut(s) 40, 285
Bso31I GGTCTC 1 cut(s) 40
Bsp143I GATC 4 cut(s) 126, 218, 280, 308
BspACI CCGC 1 cut(s) 71
BspLI GGNNCC 1 cut(s) 75
BspPI GGATC 1 cut(s) 303
BspTNI GGTCTC 1 cut(s) 40
BsrI ACTGG 1 cut(s) 77
BssMI GATC 4 cut(s) 126, 218, 280, 308
Bst2UI CCWGG 2 cut(s) 32, 114
Bst6I CTCTTC 1 cut(s) 32
BstDEI CTNAG 1 cut(s) 40
BstKTI GATC 4 cut(s) 129, 221, 283, 311
BstMAI GTCTC 2 cut(s) 40, 285
BstMBI GATC 4 cut(s) 126, 218, 280, 308
BstNI CCWGG 2 cut(s) 32, 114
BstSCI CCNGG 2 cut(s) 30, 112
BstV2I GAAGAC 1 cut(s) 73
BstX2I RGATCY 1 cut(s) 308
BstYI RGATCY 1 cut(s) 308
CviJI RGCY 4 cut(s) 24, 44, 74, 117
CviKI_1 RGCY 4 cut(s) 24, 44, 74, 117
DdeI CTNAG 1 cut(s) 40
DpnI GATC 4 cut(s) 128, 220, 282, 310
DpnII GATC 4 cut(s) 126, 218, 280, 308
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
Eco31I GGTCTC 1 cut(s) 40
Eco32I GATATC 1 cut(s) 6
EcoRII CCWGG 2 cut(s) 30, 112
EcoRV GATATC 1 cut(s) 6
FaiI YATR 7 cut(s) 19, 21, 89, 134, 328, 358, 360
Fnu4HI GCNGC 1 cut(s) 72
Fsp4HI GCNGC 1 cut(s) 72
GluI GCNGC 1 cut(s) 72
GsuI CTGGAG 1 cut(s) 60
HphI GGTGA 1 cut(s) 76
Hpy188I TCNGA 5 cut(s) 126, 189, 196, 313, 375
Hpy188III TCNNGA 3 cut(s) 249, 300, 341
HpyCH4V TGCA 3 cut(s) 110, 141, 306
HpyF3I CTNAG 1 cut(s) 40
Kzo9I GATC 4 cut(s) 126, 218, 280, 308
LmnI GCTCC 2 cut(s) 79, 251
LpnPI CCDG 6 cut(s) 17, 44, 90, 99, 126, 354
LweI GCATC 2 cut(s) 150, 293
MaeIII GTNAC 1 cut(s) 236
MalI GATC 4 cut(s) 128, 220, 282, 310
MboI GATC 4 cut(s) 126, 218, 280, 308
MboII GAAGA 2 cut(s) 19, 73
MfeI CAATTG 1 cut(s) 394
MflI RGATCY 1 cut(s) 308
MluCI AATT 2 cut(s) 389, 394
MnlI CCTC 2 cut(s) 35, 64
MseI TTAA 3 cut(s) 47, 225, 285
MspR9I CCNGG 2 cut(s) 32, 114
MunI CAATTG 1 cut(s) 394
MvaI CCWGG 2 cut(s) 32, 114
NdeII GATC 4 cut(s) 126, 218, 280, 308
NlaIV GGNNCC 1 cut(s) 75
NmuCI GTSAC 1 cut(s) 236
PkrI GCNGC 1 cut(s) 73
Psp6I CCWGG 2 cut(s) 30, 112
PspGI CCWGG 2 cut(s) 30, 112
PspN4I GGNNCC 1 cut(s) 75
PsuI RGATCY 1 cut(s) 308
SaqAI TTAA 3 cut(s) 47, 225, 285
SatI GCNGC 1 cut(s) 72
Sau3AI GATC 4 cut(s) 126, 218, 280, 308
ScrFI CCNGG 2 cut(s) 32, 114
SetI ASST 5 cut(s) 56, 108, 115, 187, 357
SfaNI GCATC 2 cut(s) 150, 293
SmlI CTYRAG 1 cut(s) 180
SmoI CTYRAG 1 cut(s) 180
Sse9I AATT 2 cut(s) 389, 394
SsiI CCGC 1 cut(s) 71
StyD4I CCNGG 2 cut(s) 30, 112
TasI AATT 2 cut(s) 389, 394
TauI GCSGC 1 cut(s) 74
Tru1I TTAA 3 cut(s) 47, 225, 285
Tru9I TTAA 3 cut(s) 47, 225, 285
TseFI GTSAC 1 cut(s) 236
Tsp45I GTSAC 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.