AT3G29970

NADH-ubiquinone reductase complex 1 MLRQ subunit

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
11745197 .. 11746570
1374 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G29970.2

Sequence Viewer

Length: 264 bp
ATGGGGCGTTGGGTGAGACCTGAGGTGTACCCTCTTCTTGGAGCAATGGGATTTGTGACATCTATGGTTGTGTTTCAACTCACAAGAAATGCATTCTTAAACCCTGACTGCAGAATAAATAAAGAGCATAGAAAAATGGGAATTCTAGAAAATAAAGACGAAGGAGAAAAATATGCACAACACAATTTTCGCAAGTATCTAAGGACCCGTCAACCTCAAGTTATGCCTTCACTCAACCGTTTCTTCTCTCAAGAGGACAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

10.38

Weight (kDa)

9.8

Isoelectric Point (pI)

52.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B12D PF06522 1 - 43 2.3e-13 NADH-ubiquinone reductase complex 1 MLRQ subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015346)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G29970 AT3G29970 AT3G29970
fragaria_vesca FvH4_6g46480
malus_domestica MD09G1073000.v1.1 MD17G1064400.v1.1
prunus_persica Prupe.3G250200_v2.0.a1
pyrus_communis pycom17g06450
rosa_chinensis RchiOBHm_Chr2g0165051
rosa_multiflora Rmu_sc0001097.1_g000024
rosa_roxburghii Rroxscaffold_2G00086090
rosa_rugosa Rorug02G0512400
rosa_samantha Rh2AG580600 Rh2CG562500 Rh2DG602000
rosa_wichuraiana Rw2G048200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 141
AfaI GTAC 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 1 cut(s) 77
Alw26I GTCTC 1 cut(s) 10
ApoI RAATTY 1 cut(s) 141
AspS9I GGNCC 1 cut(s) 204
AsuHPI GGTGA 1 cut(s) 25
AvaII GGWCC 1 cut(s) 204
AxyI CCTNAGG 1 cut(s) 21
BcoDI GTCTC 1 cut(s) 10
BfaI CTAG 1 cut(s) 146
BfmI CTRYAG 1 cut(s) 109
Bme18I GGWCC 1 cut(s) 204
BmgT120I GGNCC 1 cut(s) 204
BmiI GGNNCC 1 cut(s) 206
BpuEI CTTGAG 2 cut(s) 201, 234
BsaI GGTCTC 1 cut(s) 10
Bsc4I CCNNNNNNNGG 1 cut(s) 38
Bse21I CCTNAGG 1 cut(s) 21
Bse3DI GCAATG 1 cut(s) 51
BseLI CCNNNNNNNGG 1 cut(s) 38
BseMI GCAATG 1 cut(s) 51
BseMII CTCAG 1 cut(s) 12
BslI CCNNNNNNNGG 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 10
BsmI GAATGC 1 cut(s) 92
Bso31I GGTCTC 1 cut(s) 10
BspCNI CTCAG 1 cut(s) 13
BspLI GGNNCC 1 cut(s) 206
BspMAI CTGCAG 1 cut(s) 113
BspTNI GGTCTC 1 cut(s) 10
BsrDI GCAATG 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 239
Bst6I CTCTTC 1 cut(s) 39
BstDEI CTNAG 2 cut(s) 21, 200
BstMAI GTCTC 1 cut(s) 10
BstSFI CTRYAG 1 cut(s) 109
Bsu36I CCTNAGG 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 204
Csp6I GTAC 1 cut(s) 28
CviQI GTAC 1 cut(s) 28
DdeI CTNAG 2 cut(s) 21, 200
Eam1104I CTCTTC 1 cut(s) 39
EarI CTCTTC 1 cut(s) 39
Eco31I GGTCTC 1 cut(s) 10
Eco47I GGWCC 1 cut(s) 204
Eco81I CCTNAGG 1 cut(s) 21
EcoO109I RGGNCCY 1 cut(s) 204
EcoRI GAATTC 1 cut(s) 141
EcoT22I ATGCAT 1 cut(s) 94
FaiI YATR 4 cut(s) 65, 129, 174, 224
FspBI CTAG 1 cut(s) 146
HincII GTYRAC 1 cut(s) 212
HindII GTYRAC 1 cut(s) 212
HphI GGTGA 1 cut(s) 25
Hpy166II GTNNAC 2 cut(s) 28, 212
Hpy188III TCNNGA 2 cut(s) 146, 251
Hpy8I GTNNAC 2 cut(s) 28, 212
HpyAV CCTTC 2 cut(s) 155, 237
HpyCH4III ACNGT 1 cut(s) 239
HpyCH4V TGCA 3 cut(s) 92, 111, 176
HpyF3I CTNAG 2 cut(s) 21, 200
LmnI GCTCC 1 cut(s) 41
LpnPI CCDG 2 cut(s) 33, 117
MaeI CTAG 1 cut(s) 146
MaeIII GTNAC 1 cut(s) 55
MboII GAAGA 2 cut(s) 26, 235
MluCI AATT 2 cut(s) 141, 184
MnlI CCTC 4 cut(s) 16, 42, 225, 247
Mph1103I ATGCAT 1 cut(s) 94
MseI TTAA 1 cut(s) 98
Mva1269I GAATGC 1 cut(s) 92
NlaIV GGNNCC 1 cut(s) 206
NmuCI GTSAC 1 cut(s) 55
NsiI ATGCAT 1 cut(s) 94
PctI GAATGC 1 cut(s) 92
PpuMI RGGWCCY 1 cut(s) 204
Psp5II RGGWCCY 1 cut(s) 204
PspN4I GGNNCC 1 cut(s) 206
PspPI GGNCC 1 cut(s) 204
PspPPI RGGWCCY 1 cut(s) 204
PstI CTGCAG 1 cut(s) 113
RsaI GTAC 1 cut(s) 29
RsaNI GTAC 1 cut(s) 28
SaqAI TTAA 1 cut(s) 98
Sau96I GGNCC 1 cut(s) 204
SetI ASST 3 cut(s) 22, 27, 217
SfcI CTRYAG 1 cut(s) 109
SgeI CNNG 8 cut(s) 32, 50, 96, 116, 158, 205, 219, 230
SinI GGWCC 1 cut(s) 204
SmlI CTYRAG 2 cut(s) 216, 249
SmoI CTYRAG 2 cut(s) 216, 249
Sse9I AATT 2 cut(s) 141, 184
SspMI CTAG 1 cut(s) 146
TaaI ACNGT 1 cut(s) 239
TasI AATT 2 cut(s) 141, 184
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
VpaK11BI GGWCC 1 cut(s) 204
XapI RAATTY 1 cut(s) 141
XbaI TCTAGA 1 cut(s) 145
XspI CTAG 1 cut(s) 146
Zsp2I ATGCAT 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.