AT4G40042

signal peptidase

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Forward (+)
18559097 .. 18559570
474 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G40042.1

Sequence Viewer

Length: 282 bp
ATGGATTGGCAAGGGCAGAAATTGGCGGAGCAGTTAATGCAGATCCTGCTTCTGATCGCCGCCGTTGTGTCGTTCGTTGTTGGTTACACAACGGCGTCGTTTAGGATGATGATGTTGATTTACGCCGGAGGTGTTGTTCTGACGACTCTGATCACAATACCTAATTGGCCTTGCTTTAATCGTCATCATCTTAAGTGGTTAGATCCAAGTGAAGCAGAGAAACATCCTAAACCTCAAGTTGTTGTTGTTAGCTCCAAGAAGAAATCCTCCTCTAAAAAGTAG

Protein Analysis

93

Amino Acids

10.5

Weight (kDa)

9.78

Isoelectric Point (pI)

23.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SPC12 PF06645 1 - 70 5.7e-32 Microsomal signal peptidase 12 kDa subunit (SPC12)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014094)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 26, 60
AclWI GGATC 2 cut(s) 37, 197
AcyI GRCGYC 1 cut(s) 95
AflII CTTAAG 1 cut(s) 191
AloI GAACNNNNNNTCC 2 cut(s) 120, 152
AluBI AGCT 1 cut(s) 252
AluI AGCT 1 cut(s) 252
AlwI GGATC 2 cut(s) 37, 197
AlwNI CAGNNNCTG 1 cut(s) 46
AoxI GGCC 1 cut(s) 167
BceAI ACGGC 2 cut(s) 47, 108
BclI TGATCA 1 cut(s) 150
BfrI CTTAAG 1 cut(s) 191
BisI GCNGC 1 cut(s) 60
BlsI GCNGC 1 cut(s) 61
BpuEI CTTGAG 1 cut(s) 219
BsaHI GRCGYC 1 cut(s) 95
BsaXI ACNNNNNCTCC 2 cut(s) 120, 150
BseGI GGATG 2 cut(s) 111, 223
BseRI GAGGAG 1 cut(s) 259
BshFI GGCC 1 cut(s) 169
BsiSI CCGG 1 cut(s) 126
BsnI GGCC 1 cut(s) 169
Bsp143I GATC 4 cut(s) 42, 54, 150, 202
BspACI CCGC 2 cut(s) 26, 60
BspANI GGCC 1 cut(s) 169
BspPI GGATC 2 cut(s) 37, 197
BspTI CTTAAG 1 cut(s) 191
BssMI GATC 4 cut(s) 42, 54, 150, 202
BssNI GRCGYC 1 cut(s) 95
BstACI GRCGYC 1 cut(s) 95
BstAFI CTTAAG 1 cut(s) 191
BstAPI GCANNNNNTGC 2 cut(s) 37, 46
BstF5I GGATG 2 cut(s) 111, 223
BstKTI GATC 4 cut(s) 45, 57, 153, 205
BstMBI GATC 4 cut(s) 42, 54, 150, 202
BstMWI GCNNNNNNNGC 2 cut(s) 37, 46
BstX2I RGATCY 2 cut(s) 42, 202
BstYI RGATCY 2 cut(s) 42, 202
BsuRI GGCC 1 cut(s) 169
BtsCI GGATG 2 cut(s) 111, 223
CaiI CAGNNNCTG 1 cut(s) 46
CseI GACGC 1 cut(s) 84
CviJI RGCY 2 cut(s) 169, 252
CviKI_1 RGCY 2 cut(s) 169, 252
DpnI GATC 4 cut(s) 44, 56, 152, 204
DpnII GATC 4 cut(s) 42, 54, 150, 202
EciI GGCGGA 1 cut(s) 41
FbaI TGATCA 1 cut(s) 150
Fnu4HI GCNGC 1 cut(s) 60
FokI GGATG 2 cut(s) 118, 210
Fsp4HI GCNGC 1 cut(s) 60
GluI GCNGC 1 cut(s) 60
HaeIII GGCC 1 cut(s) 169
HapII CCGG 1 cut(s) 126
HgaI GACGC 1 cut(s) 84
Hin1I GRCGYC 1 cut(s) 95
HinfI GANTC 1 cut(s) 145
HpaII CCGG 1 cut(s) 126
Hpy188I TCNGA 3 cut(s) 54, 141, 150
Hpy99I CGWCG 1 cut(s) 100
HpyCH4V TGCA 1 cut(s) 40
HpyF10VI GCNNNNNNNGC 2 cut(s) 37, 46
Hsp92I GRCGYC 1 cut(s) 95
Ksp22I TGATCA 1 cut(s) 150
Kzo9I GATC 4 cut(s) 42, 54, 150, 202
LmnI GCTCC 2 cut(s) 28, 257
LpnPI CCDG 2 cut(s) 59, 139
MaeIII GTNAC 1 cut(s) 83
MalI GATC 4 cut(s) 44, 56, 152, 204
MboI GATC 4 cut(s) 42, 54, 150, 202
MboII GAAGA 1 cut(s) 271
MflI RGATCY 2 cut(s) 42, 202
MluCI AATT 2 cut(s) 20, 163
MlyI GAGTC 1 cut(s) 139
MnlI CCTC 4 cut(s) 122, 243, 277, 280
MseI TTAA 3 cut(s) 35, 177, 192
MspCI CTTAAG 1 cut(s) 191
MspI CCGG 1 cut(s) 126
MwoI GCNNNNNNNGC 2 cut(s) 37, 46
NdeII GATC 4 cut(s) 42, 54, 150, 202
PkrI GCNGC 1 cut(s) 61
PleI GAGTC 1 cut(s) 139
PpsI GAGTC 1 cut(s) 139
PstNI CAGNNNCTG 1 cut(s) 46
PsuI RGATCY 2 cut(s) 42, 202
SaqAI TTAA 3 cut(s) 35, 177, 192
SatI GCNGC 1 cut(s) 60
Sau3AI GATC 4 cut(s) 42, 54, 150, 202
SchI GAGTC 1 cut(s) 139
SetI ASST 4 cut(s) 133, 163, 235, 254
SgeI CNNG 7 cut(s) 23, 58, 138, 183, 219, 248, 268
SmlI CTYRAG 2 cut(s) 191, 234
SmoI CTYRAG 2 cut(s) 191, 234
Sse9I AATT 2 cut(s) 20, 163
SsiI CCGC 2 cut(s) 26, 60
TasI AATT 2 cut(s) 20, 163
TauI GCSGC 1 cut(s) 62
Tru1I TTAA 3 cut(s) 35, 177, 192
Tru9I TTAA 3 cut(s) 35, 177, 192
Vha464I CTTAAG 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.