Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0019145

Physical Location & Seq

Genomic Coordinates Reverse (-)

558285 .. 559235

Gene Structure 951 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT5G02502.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 108 bp

ATGTTTGACGACCAAGACCTCGGCTTCTTTGCCAATTTTCTGGGGATTTTCATCTTCATAATGGTCATTGCATACCATTTCGTGGTGGCAGAGCCTAAATTCGAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003729 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0031974 GO:0031981 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0070013 GO:0097159 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko03013 ko03015 ko03040 ko05168 map03013 map03015 map03040 map05168

Pfam Domains

Protein Families

FoP_duplication RRM_1

Protein Analysis

35

Amino Acids

4.13

Weight (kDa)

4.29

Isoelectric Point (pI)

18.09

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ost4	PF10215	1 - 33	4.2e-15	Oligosaccaryltransferase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019145)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G09455 AT3G09455 AT5G02502
malus_domestica	MD04G1125200.v1.1
prunus_persica	Prupe.6G252200_v2.0.a1
rosa_laevigata	RLG00000024535
rosa_samantha	Rh3BG153800 Rh3DG154900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	82
AcsI	RAATTY	1 cut(s)	98
AfiI	CCNNNNNNNGG	1 cut(s)	82
ApoI	RAATTY	1 cut(s)	98
AsuII	TTCGAA	1 cut(s)	102
Bpu14I	TTCGAA	1 cut(s)	102
BsaBI	GATNNNNATC	1 cut(s)	50
BsaJI	CCNNGG	1 cut(s)	19
Bsc4I	CCNNNNNNNGG	1 cut(s)	82
Bse3DI	GCAATG	1 cut(s)	66
Bse8I	GATNNNNATC	1 cut(s)	50
BseDI	CCNNGG	1 cut(s)	19
BseJI	GATNNNNATC	1 cut(s)	50
BseLI	CCNNNNNNNGG	1 cut(s)	82
BseMI	GCAATG	1 cut(s)	66
BslI	CCNNNNNNNGG	1 cut(s)	82
Bsp119I	TTCGAA	1 cut(s)	102
BspT104I	TTCGAA	1 cut(s)	102
BsrDI	GCAATG	1 cut(s)	66
BssECI	CCNNGG	1 cut(s)	19
BstBI	TTCGAA	1 cut(s)	102
BstXI	CCANNNNNNTGG	1 cut(s)	40
CviJI	RGCY	2 cut(s)	24, 94
CviKI_1	RGCY	2 cut(s)	24, 94
FaiI	YATR	2 cut(s)	59, 73
HpyCH4V	TGCA	1 cut(s)	71
LpnPI	CCDG	1 cut(s)	26
MboII	GAAGA	1 cut(s)	46
MluCI	AATT	2 cut(s)	34, 98
MnlI	CCTC	1 cut(s)	29
NspV	TTCGAA	1 cut(s)	102
PflMI	CCANNNNNTGG	1 cut(s)	82
SetI	ASST	1 cut(s)	21
SfuI	TTCGAA	1 cut(s)	102
SgeI	CNNG	4 cut(s)	26, 32, 53, 94
Sse9I	AATT	2 cut(s)	34, 98
TaqI	TCGA	1 cut(s)	102
TasI	AATT	2 cut(s)	34, 98
TspDTI	ATGAA	2 cut(s)	40, 46
Van91I	CCANNNNNTGG	1 cut(s)	82
XapI	RAATTY	1 cut(s)	98

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.