Rh3DG154900

Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0019145
Physical Location & Seq
Reverse (-)
13286691 .. 13291140
4450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG154900.1

Sequence Viewer

Length: 297 bp
ATGCTCAATGGCGACGCAGACCTCGATCAGCCCTGCTATCAATCTCCACCTCCAGCCCCTGCTGACGTCGTTCTCGAGTCTGGCACGATTTATAAACGTAGACCCATCGCACTCGTTACCCTCGTCGACATACAGTTACACAGAGCTTCGACTTCTGCCATTGACTCAGACTACTCGCCTCCAAAAACTATGTTTGACGATCAGGACCTGGGCTTCTTTGCCAATTTCCTTGGCATCTTCATCTTTGTTTTGGTAATCGCATATCATTATGTGATGGCTGACCCAAAATATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ost4

Protein Analysis

98

Amino Acids

10.94

Weight (kDa)

4.41

Isoelectric Point (pI)

51.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ost4 PF10215 64 - 96 1.4e-13 Oligosaccaryltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019145)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G09455 AT3G09455 AT5G02502
malus_domestica MD04G1125200.v1.1
prunus_persica Prupe.6G252200_v2.0.a1
rosa_laevigata RLG00000024535
rosa_samantha Rh3BG153800 Rh3DG154900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 93
AatII GACGTC 1 cut(s) 69
AccI GTMKAC 2 cut(s) 100, 126
AcyI GRCGYC 1 cut(s) 66
AjnI CCWGG 1 cut(s) 207
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
AlwNI CAGNNNCTG 2 cut(s) 59, 208
Ama87I CYCGRG 1 cut(s) 74
AspS9I GGNCC 1 cut(s) 205
AvaI CYCGRG 1 cut(s) 74
AvaII GGWCC 1 cut(s) 205
BccI CCATC 2 cut(s) 113, 268
BciT130I CCWGG 1 cut(s) 209
Bme1390I CCNGG 1 cut(s) 209
Bme18I GGWCC 1 cut(s) 205
BmeT110I CYCGRG 1 cut(s) 74
BmgT120I GGNCC 1 cut(s) 205
BmrFI CCNGG 1 cut(s) 209
BmsI GCATC 1 cut(s) 243
BpmI CTGGAG 1 cut(s) 36
BsaHI GRCGYC 1 cut(s) 66
BsaJI CCNNGG 2 cut(s) 208, 229
BseBI CCWGG 1 cut(s) 209
BseDI CCNNGG 2 cut(s) 208, 229
BseMII CTCAG 1 cut(s) 180
BsiHKCI CYCGRG 1 cut(s) 74
BsoBI CYCGRG 1 cut(s) 74
Bsp143I GATC 2 cut(s) 25, 199
BspCNI CTCAG 1 cut(s) 179
BssECI CCNNGG 2 cut(s) 208, 229
BssMI GATC 2 cut(s) 25, 199
BssNI GRCGYC 1 cut(s) 66
BssT1I CCWWGG 1 cut(s) 229
Bst2UI CCWGG 1 cut(s) 209
Bst4CI ACNGT 1 cut(s) 135
BstACI GRCGYC 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 166
BstKTI GATC 2 cut(s) 28, 202
BstMBI GATC 2 cut(s) 25, 199
BstNI CCWGG 1 cut(s) 209
BstSCI CCNGG 1 cut(s) 207
BtgZI GCGATG 1 cut(s) 91
CaiI CAGNNNCTG 2 cut(s) 59, 208
Cfr13I GGNCC 1 cut(s) 205
CseI GACGC 1 cut(s) 23
CviJI RGCY 5 cut(s) 31, 56, 146, 213, 278
CviKI_1 RGCY 5 cut(s) 31, 56, 146, 213, 278
DdeI CTNAG 1 cut(s) 166
DpnI GATC 2 cut(s) 27, 201
DpnII GATC 2 cut(s) 25, 199
Eco130I CCWWGG 1 cut(s) 229
Eco47I GGWCC 1 cut(s) 205
Eco88I CYCGRG 1 cut(s) 74
EcoO109I RGGNCCY 1 cut(s) 205
EcoRII CCWGG 1 cut(s) 207
EcoT14I CCWWGG 1 cut(s) 229
ErhI CCWWGG 1 cut(s) 229
FaiI YATR 6 cut(s) 93, 131, 191, 262, 270, 291
FblI GTMKAC 2 cut(s) 100, 126
GsuI CTGGAG 1 cut(s) 36
HgaI GACGC 1 cut(s) 23
Hin1I GRCGYC 1 cut(s) 66
HincII GTYRAC 1 cut(s) 127
HindII GTYRAC 1 cut(s) 127
HinfI GANTC 2 cut(s) 77, 164
Hpy166II GTNNAC 2 cut(s) 101, 127
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 2 cut(s) 74, 203
Hpy8I GTNNAC 2 cut(s) 101, 127
Hpy99I CGWCG 3 cut(s) 17, 71, 128
HpyCH4III ACNGT 1 cut(s) 135
HpyCH4IV ACGT 2 cut(s) 66, 97
HpyF3I CTNAG 1 cut(s) 166
HpySE526I ACGT 2 cut(s) 66, 97
Hsp92I GRCGYC 1 cut(s) 66
Kzo9I GATC 2 cut(s) 25, 199
LpnPI CCDG 7 cut(s) 46, 66, 66, 72, 188, 194, 221
LweI GCATC 1 cut(s) 243
MaeII ACGT 2 cut(s) 66, 97
MaeIII GTNAC 2 cut(s) 115, 135
MalI GATC 2 cut(s) 27, 201
MboI GATC 2 cut(s) 25, 199
MboII GAAGA 1 cut(s) 229
MluCI AATT 1 cut(s) 223
MlyI GAGTC 2 cut(s) 86, 158
MnlI CCTC 4 cut(s) 32, 60, 131, 189
MspR9I CCNGG 1 cut(s) 209
MvaI CCWGG 1 cut(s) 209
NdeII GATC 2 cut(s) 25, 199
PaeR7I CTCGAG 1 cut(s) 74
PcsI WCGNNNNNNNCGW 3 cut(s) 21, 72, 120
PleI GAGTC 2 cut(s) 85, 158
PpsI GAGTC 2 cut(s) 85, 158
PpuMI RGGWCCY 1 cut(s) 205
PsiI TTATAA 1 cut(s) 93
Psp5II RGGWCCY 1 cut(s) 205
Psp6I CCWGG 1 cut(s) 207
PspGI CCWGG 1 cut(s) 207
PspPI GGNCC 1 cut(s) 205
PspPPI RGGWCCY 1 cut(s) 205
PstNI CAGNNNCTG 2 cut(s) 59, 208
SalI GTCGAC 1 cut(s) 125
Sau3AI GATC 2 cut(s) 25, 199
Sau96I GGNCC 1 cut(s) 205
SchI GAGTC 2 cut(s) 86, 158
ScrFI CCNGG 1 cut(s) 209
SetI ASST 6 cut(s) 24, 52, 69, 100, 148, 210
SfaNI GCATC 1 cut(s) 243
Sfr274I CTCGAG 1 cut(s) 74
SinI GGWCC 1 cut(s) 205
SlaI CTCGAG 1 cut(s) 74
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 1 cut(s) 223
StyD4I CCNGG 1 cut(s) 207
StyI CCWWGG 1 cut(s) 229
TaaI ACNGT 1 cut(s) 135
TaiI ACGT 2 cut(s) 69, 100
TaqI TCGA 4 cut(s) 24, 75, 126, 149
TasI AATT 1 cut(s) 223
TspDTI ATGAA 1 cut(s) 229
VpaK11BI GGWCC 1 cut(s) 205
XhoI CTCGAG 1 cut(s) 74
XmiI GTMKAC 2 cut(s) 100, 126
ZraI GACGTC 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.