Rh3BG153800

Oligosaccaryltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0019145
Physical Location & Seq
Reverse (-)
13086606 .. 13090598
3993 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG153800.1

Sequence Viewer

Length: 243 bp
ATGCATAATGCTACTTACCCTTCATCTTCTTTTATCATGGTTCTACGGGTTCATGCCCACGAATCGTTTAGCCTTAGATACACCCTTCATAAAGGTCTAAAATTGAATATTGATGACTGCTCGCCTCCAAAAACTATGTTTGACGATCAGGACCTGGGCTTCTTTGCCAATTTCCTTGGCATCTTCATCTTTGTTTTGGTAATCGCGTATCATTATGTGATGGCTGACCCAAAATATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ost4

Protein Analysis

80

Amino Acids

9.28

Weight (kDa)

6.15

Isoelectric Point (pI)

53.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ost4 PF10215 46 - 78 8.7e-14 Oligosaccaryltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019145)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G09455 AT3G09455 AT5G02502
malus_domestica MD04G1125200.v1.1
prunus_persica Prupe.6G252200_v2.0.a1
rosa_laevigata RLG00000024535
rosa_samantha Rh3BG153800 Rh3DG154900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 206
AgsI TTSAA 1 cut(s) 106
AjnI CCWGG 1 cut(s) 153
AlwNI CAGNNNCTG 1 cut(s) 154
AspS9I GGNCC 1 cut(s) 151
AvaII GGWCC 1 cut(s) 151
BccI CCATC 1 cut(s) 214
BciT130I CCWGG 1 cut(s) 155
Bme1390I CCNGG 1 cut(s) 155
Bme18I GGWCC 1 cut(s) 151
BmgT120I GGNCC 1 cut(s) 151
BmrFI CCNGG 1 cut(s) 155
BmsI GCATC 1 cut(s) 189
BsaJI CCNNGG 2 cut(s) 154, 175
BseBI CCWGG 1 cut(s) 155
BseDI CCNNGG 2 cut(s) 154, 175
Bsh1236I CGCG 1 cut(s) 206
Bsp143I GATC 1 cut(s) 145
BspFNI CGCG 1 cut(s) 206
BssECI CCNNGG 2 cut(s) 154, 175
BssMI GATC 1 cut(s) 145
BssT1I CCWWGG 1 cut(s) 175
Bst2UI CCWGG 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 122
BstDEI CTNAG 1 cut(s) 74
BstFNI CGCG 1 cut(s) 206
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
BstNI CCWGG 1 cut(s) 155
BstSCI CCNGG 1 cut(s) 153
BstUI CGCG 1 cut(s) 206
Cac8I GCNNGC 1 cut(s) 122
CaiI CAGNNNCTG 1 cut(s) 154
Cfr13I GGNCC 1 cut(s) 151
CviAII CATG 2 cut(s) 37, 53
CviJI RGCY 3 cut(s) 72, 159, 224
CviKI_1 RGCY 3 cut(s) 72, 159, 224
DdeI CTNAG 1 cut(s) 74
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
Eco130I CCWWGG 1 cut(s) 175
Eco47I GGWCC 1 cut(s) 151
EcoO109I RGGNCCY 1 cut(s) 151
EcoRII CCWGG 1 cut(s) 153
EcoT14I CCWWGG 1 cut(s) 175
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 2 cut(s) 40, 56
FaiI YATR 7 cut(s) 6, 38, 54, 90, 137, 216, 237
FatI CATG 2 cut(s) 36, 52
Hin1II CATG 2 cut(s) 40, 56
HinfI GANTC 1 cut(s) 62
Hpy188III TCNNGA 1 cut(s) 149
HpyAV CCTTC 2 cut(s) 30, 95
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 2 cut(s) 40, 56
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 3 cut(s) 134, 140, 167
LweI GCATC 1 cut(s) 189
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 2 cut(s) 18, 175
MluCI AATT 2 cut(s) 101, 169
MnlI CCTC 1 cut(s) 135
Mph1103I ATGCAT 1 cut(s) 6
MspR9I CCNGG 1 cut(s) 155
MvaI CCWGG 1 cut(s) 155
MvnI CGCG 1 cut(s) 206
NdeII GATC 1 cut(s) 145
NlaIII CATG 2 cut(s) 40, 56
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 62
PpuMI RGGWCCY 1 cut(s) 151
Psp5II RGGWCCY 1 cut(s) 151
Psp6I CCWGG 1 cut(s) 153
PspGI CCWGG 1 cut(s) 153
PspPI GGNCC 1 cut(s) 151
PspPPI RGGWCCY 1 cut(s) 151
PstNI CAGNNNCTG 1 cut(s) 154
Sau3AI GATC 1 cut(s) 145
Sau96I GGNCC 1 cut(s) 151
ScrFI CCNGG 1 cut(s) 155
SetI ASST 2 cut(s) 97, 156
SfaNI GCATC 1 cut(s) 189
SinI GGWCC 1 cut(s) 151
Sse9I AATT 2 cut(s) 101, 169
SspI AATATT 1 cut(s) 109
StyD4I CCNGG 1 cut(s) 153
StyI CCWWGG 1 cut(s) 175
TasI AATT 2 cut(s) 101, 169
TfiI GAWTC 1 cut(s) 62
TspDTI ATGAA 4 cut(s) 12, 41, 77, 175
VpaK11BI GGWCC 1 cut(s) 151
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.