AT5G10810

Enhancer of rudimentary homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0015988
Physical Location & Seq
Reverse (-)
3418610 .. 3420692
2083 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G10810.1

Sequence Viewer

Length: 330 bp
ATGGCTAATCACAACAGTAGTAGGCACACAATCATCTTGTTGCAGAATTCTCCGAGCAGAGCTACGAGGACTTTCATGGACTATGACTCTATAGGCCAAGCTATGGATGGTATTTGCGGCTTATATGAAAGGAAGTTGAAGGAAATTAACCCTTCTCTCAGAAATATTAGCTATGACATTGCTGACCTTTACAATTTTATTGATGGTCTTGCTGACTTGAGCGCTTTGGTCTATGACCACTCGATAAGTGCATATCTGCCATATGACAGGCAATGGATTAAGCAGAAGGCATTTCACCATCTGAAGAGAATTGCCAATGGAGGCAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ER

Protein Analysis

109

Amino Acids

12.5

Weight (kDa)

8.76

Isoelectric Point (pI)

51.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ER PF01133 8 - 104 1.7e-41 Enhancer of rudimentary
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015988)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G10810
fragaria_vesca FvH4_2g41220 FvH4_2g41220
malus_domestica MD08G1054800.v1.1 MD15G1042200.v1.1
prunus_persica Prupe.1G395400_v2.0.a1 Prupe.1G395400_v2.0.a1
pyrus_communis pycom15g03920
rosa_chinensis RchiOBHm_Chr6g0299291
rosa_laevigata RLG00000011445
rosa_multiflora Rmu_sc0001434.1_g000003
rosa_roxburghii Rroxscaffold_7G00168820
rosa_samantha Rh6AG398400 Rh6BG406800
rosa_wichuraiana Rw6G034870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 103
AciI CCGC 1 cut(s) 117
AcsI RAATTY 1 cut(s) 46
AcuI CTGAAG 1 cut(s) 323
AfeI AGCGCT 1 cut(s) 223
AfiI CCNNNNNNNGG 1 cut(s) 103
AgsI TTSAA 1 cut(s) 139
AluBI AGCT 3 cut(s) 62, 101, 171
AluI AGCT 3 cut(s) 62, 101, 171
Aor51HI AGCGCT 1 cut(s) 223
AoxI GGCC 1 cut(s) 94
ApoI RAATTY 1 cut(s) 46
AspLEI GCGC 1 cut(s) 224
AsuHPI GGTGA 1 cut(s) 287
BccI CCATC 3 cut(s) 101, 197, 306
BfmI CTRYAG 1 cut(s) 90
BfoI RGCGCY 1 cut(s) 225
BisI GCNGC 1 cut(s) 118
BlsI GCNGC 1 cut(s) 119
BpuEI CTTGAG 1 cut(s) 238
Bsc4I CCNNNNNNNGG 1 cut(s) 103
Bse3DI GCAATG 2 cut(s) 177, 278
BseGI GGATG 1 cut(s) 112
BseLI CCNNNNNNNGG 1 cut(s) 103
BseMI GCAATG 2 cut(s) 177, 278
BseMII CTCAG 1 cut(s) 172
BshFI GGCC 1 cut(s) 96
BslI CCNNNNNNNGG 1 cut(s) 103
BsnI GGCC 1 cut(s) 96
BspACI CCGC 1 cut(s) 117
BspANI GGCC 1 cut(s) 96
BspCNI CTCAG 1 cut(s) 171
BsrDI GCAATG 2 cut(s) 177, 278
Bst4CI ACNGT 1 cut(s) 17
Bst6I CTCTTC 1 cut(s) 299
BstDEI CTNAG 1 cut(s) 158
BstF5I GGATG 1 cut(s) 112
BstH2I RGCGCY 1 cut(s) 225
BstHHI GCGC 1 cut(s) 224
BstSFI CTRYAG 1 cut(s) 90
BsuRI GGCC 1 cut(s) 96
BtsCI GGATG 1 cut(s) 112
CfoI GCGC 1 cut(s) 224
CviAII CATG 1 cut(s) 76
CviJI RGCY 6 cut(s) 5, 62, 96, 101, 120, 171
CviKI_1 RGCY 6 cut(s) 5, 62, 96, 101, 120, 171
DdeI CTNAG 1 cut(s) 158
Eam1104I CTCTTC 1 cut(s) 299
EarI CTCTTC 1 cut(s) 299
Eco47III AGCGCT 1 cut(s) 223
Eco57I CTGAAG 1 cut(s) 323
EcoRI GAATTC 1 cut(s) 46
FaeI CATG 1 cut(s) 79
FatI CATG 1 cut(s) 75
FauNDI CATATG 1 cut(s) 262
Fnu4HI GCNGC 1 cut(s) 118
FokI GGATG 1 cut(s) 119
Fsp4HI GCNGC 1 cut(s) 118
GlaI GCGC 1 cut(s) 223
GluI GCNGC 1 cut(s) 118
HaeII RGCGCY 1 cut(s) 225
HaeIII GGCC 1 cut(s) 96
HhaI GCGC 1 cut(s) 224
Hin1II CATG 1 cut(s) 79
Hin6I GCGC 1 cut(s) 222
HinP1I GCGC 1 cut(s) 222
HinfI GANTC 1 cut(s) 86
HphI GGTGA 1 cut(s) 287
Hpy188I TCNGA 3 cut(s) 54, 161, 303
HpyAV CCTTC 3 cut(s) 133, 162, 280
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4V TGCA 2 cut(s) 43, 251
HpyF3I CTNAG 1 cut(s) 158
Hsp92II CATG 1 cut(s) 79
HspAI GCGC 1 cut(s) 222
LpnPI CCDG 1 cut(s) 253
MboII GAAGA 1 cut(s) 316
MluCI AATT 4 cut(s) 46, 144, 193, 309
MlyI GAGTC 1 cut(s) 80
MnlI CCTC 2 cut(s) 60, 314
MseI TTAA 2 cut(s) 147, 279
NdeI CATATG 1 cut(s) 262
NlaIII CATG 1 cut(s) 79
PflMI CCANNNNNTGG 1 cut(s) 103
PkrI GCNGC 1 cut(s) 119
PleI GAGTC 1 cut(s) 80
PpsI GAGTC 1 cut(s) 80
SaqAI TTAA 2 cut(s) 147, 279
SatI GCNGC 1 cut(s) 118
SchI GAGTC 1 cut(s) 80
SetI ASST 4 cut(s) 64, 103, 173, 189
SfcI CTRYAG 1 cut(s) 90
SgeI CNNG 9 cut(s) 49, 66, 78, 88, 110, 221, 229, 253, 280
SmlI CTYRAG 1 cut(s) 217
SmoI CTYRAG 1 cut(s) 217
Sse9I AATT 4 cut(s) 46, 144, 193, 309
SsiI CCGC 1 cut(s) 117
SspI AATATT 1 cut(s) 166
TaaI ACNGT 1 cut(s) 17
TaqI TCGA 1 cut(s) 242
TasI AATT 4 cut(s) 46, 144, 193, 309
TauI GCSGC 1 cut(s) 120
Tru1I TTAA 2 cut(s) 147, 279
Tru9I TTAA 2 cut(s) 147, 279
TspDTI ATGAA 2 cut(s) 64, 141
Van91I CCANNNNNTGG 1 cut(s) 103
XapI RAATTY 1 cut(s) 46
XcmI CCANNNNNNNNNTGG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.