MD15G1042200.v1.1

Enhancer of rudimentary homolog

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
2948522 .. 2951261
2740 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1042200.v1.1.491

Sequence Viewer

Length: 309 bp
ATGGCGAACAAGCACACGATCATTCTAATGCAAACTTCTCACAACAAAGCAAGTAGAACCTTTATGGACTATGATTCCATAAGTCAAGCAATGGATGGTATATGTGGACTGTATGAGAGGAAGCTGAGGGAGTTAAATCCAGCAATTAGAGATATCTCTTATGACATCGGAGATCTCTACAATTTCATTGATGGCCTTGCCGACATGAGTGCTTTAGTATATGATCATTCGATTCAGGCATATCTCCCCTATGACCGACAGTGGATTAAACAACGGACACTTCGACATCTGCAAAAACTGGCGCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.93

Weight (kDa)

6.96

Isoelectric Point (pI)

46.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ER PF01133 4 - 100 5.7e-41 Enhancer of rudimentary
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015988)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G10810
fragaria_vesca FvH4_2g41220 FvH4_2g41220
malus_domestica MD08G1054800.v1.1 MD15G1042200.v1.1
prunus_persica Prupe.1G395400_v2.0.a1 Prupe.1G395400_v2.0.a1
pyrus_communis pycom15g03920
rosa_chinensis RchiOBHm_Chr6g0299291
rosa_laevigata RLG00000011445
rosa_multiflora Rmu_sc0001434.1_g000003
rosa_roxburghii Rroxscaffold_7G00168820
rosa_samantha Rh6AG398400 Rh6BG406800
rosa_wichuraiana Rw6G034870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
AoxI GGCC 1 cut(s) 193
AspLEI GCGC 1 cut(s) 304
BbvCI CCTCAGC 1 cut(s) 125
BccI CCATC 2 cut(s) 89, 185
BcgI CGANNNNNNTGC 2 cut(s) 191, 225
BclI TGATCA 1 cut(s) 223
BglII AGATCT 1 cut(s) 172
Bpu10I CCTNAGC 1 cut(s) 125
Bse1I ACTGG 1 cut(s) 303
Bse3DI GCAATG 1 cut(s) 96
BseGI GGATG 1 cut(s) 100
BseMI GCAATG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 116
BseNI ACTGG 1 cut(s) 303
BshFI GGCC 1 cut(s) 195
BsnI GGCC 1 cut(s) 195
Bsp143I GATC 3 cut(s) 18, 172, 223
BspANI GGCC 1 cut(s) 195
BspCNI CTCAG 1 cut(s) 117
BsrDI GCAATG 1 cut(s) 96
BsrI ACTGG 1 cut(s) 303
BssMI GATC 3 cut(s) 18, 172, 223
Bst4CI ACNGT 2 cut(s) 111, 261
BstDEI CTNAG 1 cut(s) 125
BstF5I GGATG 1 cut(s) 100
BstHHI GCGC 1 cut(s) 304
BstKTI GATC 3 cut(s) 21, 175, 226
BstMBI GATC 3 cut(s) 18, 172, 223
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BsuRI GGCC 1 cut(s) 195
BtsCI GGATG 1 cut(s) 100
BtsIMutI CAGTG 1 cut(s) 266
CfoI GCGC 1 cut(s) 304
CviAII CATG 1 cut(s) 205
CviJI RGCY 2 cut(s) 124, 195
CviKI_1 RGCY 2 cut(s) 124, 195
DdeI CTNAG 1 cut(s) 125
DpnI GATC 3 cut(s) 20, 174, 225
DpnII GATC 3 cut(s) 18, 172, 223
Eco32I GATATC 1 cut(s) 154
EcoRV GATATC 1 cut(s) 154
FaeI CATG 1 cut(s) 208
FatI CATG 1 cut(s) 204
FbaI TGATCA 1 cut(s) 223
FokI GGATG 1 cut(s) 107
GlaI GCGC 1 cut(s) 303
HaeIII GGCC 1 cut(s) 195
HhaI GCGC 1 cut(s) 304
Hin1II CATG 1 cut(s) 208
Hin6I GCGC 1 cut(s) 302
HinP1I GCGC 1 cut(s) 302
HinfI GANTC 2 cut(s) 74, 232
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 107
HpyCH4III ACNGT 2 cut(s) 111, 261
HpyCH4V TGCA 2 cut(s) 31, 292
HpyF3I CTNAG 1 cut(s) 125
Hsp92II CATG 1 cut(s) 208
HspAI GCGC 1 cut(s) 302
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 3 cut(s) 18, 172, 223
LpnPI CCDG 3 cut(s) 153, 221, 284
MalI GATC 3 cut(s) 20, 174, 225
MboI GATC 3 cut(s) 18, 172, 223
MflI RGATCY 1 cut(s) 172
MluCI AATT 2 cut(s) 144, 181
MnlI CCTC 2 cut(s) 111, 120
MseI TTAA 2 cut(s) 134, 267
MslI CAYNNNNRTG 1 cut(s) 26
NdeII GATC 3 cut(s) 18, 172, 223
NlaIII CATG 1 cut(s) 208
PcsI WCGNNNNNNNCGW 1 cut(s) 280
PfeI GAWTC 2 cut(s) 74, 232
PsuI RGATCY 1 cut(s) 172
RseI CAYNNNNRTG 1 cut(s) 26
SaqAI TTAA 2 cut(s) 134, 267
Sau3AI GATC 3 cut(s) 18, 172, 223
SetI ASST 2 cut(s) 62, 126
SgeI CNNG 8 cut(s) 22, 28, 63, 98, 152, 209, 217, 248
SmiMI CAYNNNNRTG 1 cut(s) 26
Sse9I AATT 2 cut(s) 144, 181
TaaI ACNGT 2 cut(s) 111, 261
TaqI TCGA 2 cut(s) 230, 283
TaqII GACCGA 1 cut(s) 270
TasI AATT 2 cut(s) 144, 181
TfiI GAWTC 2 cut(s) 74, 232
Tru1I TTAA 2 cut(s) 134, 267
Tru9I TTAA 2 cut(s) 134, 267
TscAI CASTG 1 cut(s) 266
TspDTI ATGAA 1 cut(s) 175
TspGWI ACGGA 1 cut(s) 289
TspRI CASTG 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.