Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0015988

Physical Location & Seq

Genomic Coordinates Forward (+)

9594736 .. 9597278

Gene Structure 2543 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00168820.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 309 bp

ATGGCTAACAAGCACACCATCATTCTTATGCAAACTTCACAGAACAAGGCAACGAGAACTTTTATGGATTATGGTTCAATAAGTCAAGCAATGGATGGTATATGTGGACTATATGAGAGGAAGCTCAGGGAGTTAAATCCGGCAATTAGAAATATCTCTTATGACATCGGAGATCTCTACAATTTTATTGATGGCCTTGCTGACATGAGTGCTTTGGTTTTTGACCACTCAATTCAGGCTTATCTGCCATATGACCGACAATGGATTAAACAGCGAACACTCCGACATCTACAGAAACTGGCACATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

102

Amino Acids

11.86

Weight (kDa)

8.79

Isoelectric Point (pI)

44.61

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
ER	PF01133	4 - 100	1.5e-40	Enhancer of rudimentary

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015988)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G10810
fragaria_vesca	FvH4_2g41220 FvH4_2g41220
malus_domestica	MD08G1054800.v1.1 MD15G1042200.v1.1
prunus_persica	Prupe.1G395400_v2.0.a1 Prupe.1G395400_v2.0.a1
pyrus_communis	pycom15g03920
rosa_chinensis	RchiOBHm_Chr6g0299291
rosa_laevigata	RLG00000011445
rosa_multiflora	Rmu_sc0001434.1_g000003
rosa_roxburghii	Rroxscaffold_7G00168820
rosa_samantha	Rh6AG398400 Rh6BG406800
rosa_wichuraiana	Rw6G034870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	78
AluBI	AGCT	1 cut(s)	124
AluI	AGCT	1 cut(s)	124
AlwNI	CAGNNNCTG	1 cut(s)	298
AoxI	GGCC	1 cut(s)	193
BccI	CCATC	3 cut(s)	26, 89, 185
BfmI	CTRYAG	1 cut(s)	290
BglII	AGATCT	1 cut(s)	172
Bpu10I	CCTNAGC	1 cut(s)	125
Bse1I	ACTGG	1 cut(s)	303
Bse3DI	GCAATG	1 cut(s)	96
BseGI	GGATG	1 cut(s)	100
BseMI	GCAATG	1 cut(s)	96
BseMII	CTCAG	1 cut(s)	139
BseNI	ACTGG	1 cut(s)	303
BshFI	GGCC	1 cut(s)	195
BsiSI	CCGG	1 cut(s)	140
BsnI	GGCC	1 cut(s)	195
Bsp143I	GATC	1 cut(s)	172
BspANI	GGCC	1 cut(s)	195
BspCNI	CTCAG	1 cut(s)	138
BsrDI	GCAATG	1 cut(s)	96
BsrI	ACTGG	1 cut(s)	303
BssMI	GATC	1 cut(s)	172
BstDEI	CTNAG	1 cut(s)	125
BstF5I	GGATG	1 cut(s)	100
BstKTI	GATC	1 cut(s)	175
BstMBI	GATC	1 cut(s)	172
BstSFI	CTRYAG	1 cut(s)	290
BstX2I	RGATCY	1 cut(s)	172
BstYI	RGATCY	1 cut(s)	172
BsuRI	GGCC	1 cut(s)	195
BtsCI	GGATG	1 cut(s)	100
CaiI	CAGNNNCTG	1 cut(s)	298
CviAII	CATG	1 cut(s)	205
CviJI	RGCY	4 cut(s)	5, 124, 195, 239
CviKI_1	RGCY	4 cut(s)	5, 124, 195, 239
DdeI	CTNAG	1 cut(s)	125
DpnI	GATC	1 cut(s)	174
DpnII	GATC	1 cut(s)	172
FaeI	CATG	1 cut(s)	208
FatI	CATG	1 cut(s)	204
FauNDI	CATATG	1 cut(s)	250
FokI	GGATG	1 cut(s)	107
HaeIII	GGCC	1 cut(s)	195
HapII	CCGG	1 cut(s)	140
Hin1II	CATG	1 cut(s)	208
HpaII	CCGG	1 cut(s)	140
Hpy166II	GTNNAC	1 cut(s)	107
Hpy188I	TCNGA	2 cut(s)	170, 284
Hpy8I	GTNNAC	1 cut(s)	107
HpyCH4V	TGCA	1 cut(s)	31
HpyF3I	CTNAG	1 cut(s)	125
Hsp92II	CATG	1 cut(s)	208
Kzo9I	GATC	1 cut(s)	172
LpnPI	CCDG	4 cut(s)	112, 153, 221, 284
MalI	GATC	1 cut(s)	174
MboI	GATC	1 cut(s)	172
MflI	RGATCY	1 cut(s)	172
MluCI	AATT	3 cut(s)	144, 181, 231
MmeI	TCCRAC	1 cut(s)	307
MnlI	CCTC	1 cut(s)	111
MseI	TTAA	3 cut(s)	134, 267, 307
MslI	CAYNNNNRTG	1 cut(s)	26
MspI	CCGG	1 cut(s)	140
NdeI	CATATG	1 cut(s)	250
NdeII	GATC	1 cut(s)	172
NlaIII	CATG	1 cut(s)	208
PstNI	CAGNNNCTG	1 cut(s)	298
PsuI	RGATCY	1 cut(s)	172
RseI	CAYNNNNRTG	1 cut(s)	26
SaqAI	TTAA	3 cut(s)	134, 267, 307
Sau3AI	GATC	1 cut(s)	172
SetI	ASST	1 cut(s)	126
SfcI	CTRYAG	1 cut(s)	290
SgeI	CNNG	9 cut(s)	22, 58, 66, 98, 139, 152, 209, 217, 248
SmiMI	CAYNNNNRTG	1 cut(s)	26
Sse9I	AATT	3 cut(s)	144, 181, 231
TaqII	GACCGA	1 cut(s)	270
TasI	AATT	3 cut(s)	144, 181, 231
Tru1I	TTAA	3 cut(s)	134, 267, 307
Tru9I	TTAA	3 cut(s)	134, 267, 307

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.