Rw6G034870

Enhancer of rudimentary homolog

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Reverse (-)
59472271 .. 59474971
2701 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G034870.1

Sequence Viewer

Length: 309 bp
ATGGCTAACAAGCACACCATCATTCTTATGCAAACTTCACAGAACAAGGCAACGAGAACTTTTATGGATTATGGTTCAATAAGTCAAGCAATGGATGGTATATGTGGACTATATGAGAGGAAGCTCAGGGAGTTAAATCCAGCAATTAGAAATATGTCTTATGACATCGGAGATCTCTACAATTTTATTGATGGCCTTGCTGACATGAGTGCTTTGGTTTATGACCACTCAATTCAGGCTTATCTGCCATATGACCGACAATGGATTAAACAGCGGACACTCCGACATCTACAGAAATTGGCACATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.9

Weight (kDa)

8.76

Isoelectric Point (pI)

44.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ER PF01133 4 - 100 3.9e-40 Enhancer of rudimentary
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015988)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G10810
fragaria_vesca FvH4_2g41220 FvH4_2g41220
malus_domestica MD08G1054800.v1.1 MD15G1042200.v1.1
prunus_persica Prupe.1G395400_v2.0.a1 Prupe.1G395400_v2.0.a1
pyrus_communis pycom15g03920
rosa_chinensis RchiOBHm_Chr6g0299291
rosa_laevigata RLG00000011445
rosa_multiflora Rmu_sc0001434.1_g000003
rosa_roxburghii Rroxscaffold_7G00168820
rosa_samantha Rh6AG398400 Rh6BG406800
rosa_wichuraiana Rw6G034870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 274
AgsI TTSAA 1 cut(s) 78
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
AoxI GGCC 1 cut(s) 193
BccI CCATC 3 cut(s) 26, 89, 185
BfmI CTRYAG 1 cut(s) 290
BglII AGATCT 1 cut(s) 172
Bpu10I CCTNAGC 1 cut(s) 125
Bse3DI GCAATG 1 cut(s) 96
BseGI GGATG 1 cut(s) 100
BseMI GCAATG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 139
BshFI GGCC 1 cut(s) 195
BsnI GGCC 1 cut(s) 195
Bsp143I GATC 1 cut(s) 172
BspACI CCGC 1 cut(s) 274
BspANI GGCC 1 cut(s) 195
BspCNI CTCAG 1 cut(s) 138
BsrDI GCAATG 1 cut(s) 96
BssMI GATC 1 cut(s) 172
BstDEI CTNAG 1 cut(s) 125
BstF5I GGATG 1 cut(s) 100
BstKTI GATC 1 cut(s) 175
BstMBI GATC 1 cut(s) 172
BstSFI CTRYAG 1 cut(s) 290
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BsuRI GGCC 1 cut(s) 195
BtsCI GGATG 1 cut(s) 100
CviAII CATG 1 cut(s) 205
CviJI RGCY 4 cut(s) 5, 124, 195, 239
CviKI_1 RGCY 4 cut(s) 5, 124, 195, 239
DdeI CTNAG 1 cut(s) 125
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
FaeI CATG 1 cut(s) 208
FatI CATG 1 cut(s) 204
FauNDI CATATG 1 cut(s) 250
FokI GGATG 1 cut(s) 107
HaeIII GGCC 1 cut(s) 195
Hin1II CATG 1 cut(s) 208
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 2 cut(s) 170, 284
Hpy8I GTNNAC 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 31
HpyF3I CTNAG 1 cut(s) 125
Hsp92II CATG 1 cut(s) 208
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 3 cut(s) 112, 153, 221
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MflI RGATCY 1 cut(s) 172
MluCI AATT 4 cut(s) 144, 181, 231, 296
MmeI TCCRAC 1 cut(s) 307
MnlI CCTC 1 cut(s) 111
MseI TTAA 3 cut(s) 134, 267, 307
MslI CAYNNNNRTG 1 cut(s) 26
MspA1I CMGCKG 1 cut(s) 274
NdeI CATATG 1 cut(s) 250
NdeII GATC 1 cut(s) 172
NlaIII CATG 1 cut(s) 208
PsuI RGATCY 1 cut(s) 172
RseI CAYNNNNRTG 1 cut(s) 26
SaqAI TTAA 3 cut(s) 134, 267, 307
Sau3AI GATC 1 cut(s) 172
SetI ASST 1 cut(s) 126
SfcI CTRYAG 1 cut(s) 290
SgeI CNNG 9 cut(s) 22, 58, 66, 98, 139, 152, 209, 217, 248
SmiMI CAYNNNNRTG 1 cut(s) 26
Sse9I AATT 4 cut(s) 144, 181, 231, 296
SsiI CCGC 1 cut(s) 274
TaqII GACCGA 1 cut(s) 270
TasI AATT 4 cut(s) 144, 181, 231, 296
Tru1I TTAA 3 cut(s) 134, 267, 307
Tru9I TTAA 3 cut(s) 134, 267, 307
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.