Prupe.1G395400_v2.0.a1

Enhancer of rudimentary homolog

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
35104051 .. 35107499
3449 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G395400.1

Sequence Viewer

Length: 309 bp
ATGGCTAACAAGCACACCATCATTCTAATGCAAACTTCTCAGAACAAAGCAACTAGAACCTTTATGGACTATGATTCAATAAGTCAAGCAATGGATGGTATATGTGGACTGTATGAGAGGAAGCTGAGGGAGTTAAATCCAGCAATTAGAAATATCTCATACGATATTGGAGATCTCTACAACTTTATTGATGGCCTCACTGACATGAGTGCTTTAGTTTATGATCACTCAATTCAAGCTTATCTGCCGTATGACCGACAATGGATTAAACAACGGACACTTCGACATCTGCAGAAACTGGCACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.97

Weight (kDa)

7.89

Isoelectric Point (pI)

50.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015988)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G10810
fragaria_vesca FvH4_2g41220 FvH4_2g41220
malus_domestica MD08G1054800.v1.1 MD15G1042200.v1.1
prunus_persica Prupe.1G395400_v2.0.a1 Prupe.1G395400_v2.0.a1
pyrus_communis pycom15g03920
rosa_chinensis RchiOBHm_Chr6g0299291
rosa_laevigata RLG00000011445
rosa_multiflora Rmu_sc0001434.1_g000003
rosa_roxburghii Rroxscaffold_7G00168820
rosa_samantha Rh6AG398400 Rh6BG406800
rosa_wichuraiana Rw6G034870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 78, 236
AluBI AGCT 2 cut(s) 124, 239
AluI AGCT 2 cut(s) 124, 239
AlwNI CAGNNNCTG 1 cut(s) 298
AoxI GGCC 1 cut(s) 193
BbvCI CCTCAGC 1 cut(s) 125
BccI CCATC 3 cut(s) 26, 89, 185
BceAI ACGGC 1 cut(s) 232
BclI TGATCA 1 cut(s) 223
BfaI CTAG 1 cut(s) 54
BfmI CTRYAG 1 cut(s) 290
BglII AGATCT 1 cut(s) 172
Bpu10I CCTNAGC 1 cut(s) 125
Bse1I ACTGG 1 cut(s) 303
Bse3DI GCAATG 1 cut(s) 96
BseGI GGATG 1 cut(s) 100
BseMI GCAATG 1 cut(s) 96
BseMII CTCAG 2 cut(s) 53, 116
BseNI ACTGG 1 cut(s) 303
BshFI GGCC 1 cut(s) 195
BsnI GGCC 1 cut(s) 195
Bsp143I GATC 2 cut(s) 172, 223
BspANI GGCC 1 cut(s) 195
BspCNI CTCAG 2 cut(s) 52, 117
BspMAI CTGCAG 1 cut(s) 294
BsrDI GCAATG 1 cut(s) 96
BsrI ACTGG 1 cut(s) 303
BssMI GATC 2 cut(s) 172, 223
Bst4CI ACNGT 1 cut(s) 111
BstDEI CTNAG 2 cut(s) 39, 125
BstF5I GGATG 1 cut(s) 100
BstKTI GATC 2 cut(s) 175, 226
BstMBI GATC 2 cut(s) 172, 223
BstSFI CTRYAG 1 cut(s) 290
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BsuRI GGCC 1 cut(s) 195
BtsCI GGATG 1 cut(s) 100
BtsIMutI CAGTG 1 cut(s) 198
CaiI CAGNNNCTG 1 cut(s) 298
CviAII CATG 1 cut(s) 205
CviJI RGCY 4 cut(s) 5, 124, 195, 239
CviKI_1 RGCY 4 cut(s) 5, 124, 195, 239
DdeI CTNAG 2 cut(s) 39, 125
DpnI GATC 2 cut(s) 174, 225
DpnII GATC 2 cut(s) 172, 223
FaeI CATG 1 cut(s) 208
FaiI YATR 9 cut(s) 65, 72, 101, 103, 114, 160, 206, 222, 252
FatI CATG 1 cut(s) 204
FbaI TGATCA 1 cut(s) 223
FokI GGATG 1 cut(s) 107
FspBI CTAG 1 cut(s) 54
HaeIII GGCC 1 cut(s) 195
Hin1II CATG 1 cut(s) 208
HindIII AAGCTT 1 cut(s) 237
HinfI GANTC 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 42
Hpy8I GTNNAC 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 111
HpyCH4V TGCA 2 cut(s) 31, 292
HpyF3I CTNAG 2 cut(s) 39, 125
Hsp92II CATG 1 cut(s) 208
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 2 cut(s) 172, 223
LpnPI CCDG 2 cut(s) 153, 284
MaeI CTAG 1 cut(s) 54
MalI GATC 2 cut(s) 174, 225
MboI GATC 2 cut(s) 172, 223
MflI RGATCY 1 cut(s) 172
MluCI AATT 2 cut(s) 144, 231
MnlI CCTC 3 cut(s) 111, 120, 206
MseI TTAA 2 cut(s) 134, 267
MslI CAYNNNNRTG 2 cut(s) 26, 203
NdeII GATC 2 cut(s) 172, 223
NlaIII CATG 1 cut(s) 208
PcsI WCGNNNNNNNCGW 1 cut(s) 280
PfeI GAWTC 1 cut(s) 74
PstI CTGCAG 1 cut(s) 294
PstNI CAGNNNCTG 1 cut(s) 298
PsuI RGATCY 1 cut(s) 172
RseI CAYNNNNRTG 2 cut(s) 26, 203
SaqAI TTAA 2 cut(s) 134, 267
Sau3AI GATC 2 cut(s) 172, 223
SetI ASST 3 cut(s) 62, 126, 241
SfcI CTRYAG 1 cut(s) 290
SgeI CNNG 6 cut(s) 22, 66, 98, 152, 217, 248
SmiMI CAYNNNNRTG 2 cut(s) 26, 203
Sse9I AATT 2 cut(s) 144, 231
SspMI CTAG 1 cut(s) 54
TaaI ACNGT 1 cut(s) 111
TaqI TCGA 1 cut(s) 283
TaqII GACCGA 1 cut(s) 270
TasI AATT 2 cut(s) 144, 231
TfiI GAWTC 1 cut(s) 74
Tru1I TTAA 2 cut(s) 134, 267
Tru9I TTAA 2 cut(s) 134, 267
TscAI CASTG 1 cut(s) 205
TspGWI ACGGA 1 cut(s) 289
TspRI CASTG 1 cut(s) 205
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.