MD08G1054800.v1.1

Enhancer of rudimentary homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0015988
Physical Location & Seq
Reverse (-)
4295114 .. 4297295
2182 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1054800.v1.1.491

Sequence Viewer

Length: 309 bp
ATGGCGAACAAGCACACGATCATTCTAATGCAAACTTCTCACAACAAAGCAAGTAGAACCTTTATGGACTATGATTCTATAAGTCAAGCAATGGATGGTATATGTGGACTATATGAGAGGAAGCTGAGGGAGTTAAATCCAGCAATTAGAGATATCTCTTACGACATCGGAGATCTCTACAATTTCATTGATGGTCTTGCTGACATGAGTGCTTTAGTTTATGACCACTCAATTCAGGGATATCTCCCATACGACAGACAGTGGATTAAACAACGGACGCTTCGACATCTTCAGAAACTTGCACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ER

Protein Analysis

103

Amino Acids

11.92

Weight (kDa)

6.96

Isoelectric Point (pI)

46.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ER PF01133 4 - 100 1.6e-40 Enhancer of rudimentary
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015988)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G10810
fragaria_vesca FvH4_2g41220 FvH4_2g41220
malus_domestica MD08G1054800.v1.1 MD15G1042200.v1.1
prunus_persica Prupe.1G395400_v2.0.a1 Prupe.1G395400_v2.0.a1
pyrus_communis pycom15g03920
rosa_chinensis RchiOBHm_Chr6g0299291
rosa_laevigata RLG00000011445
rosa_multiflora Rmu_sc0001434.1_g000003
rosa_roxburghii Rroxscaffold_7G00168820
rosa_samantha Rh6AG398400 Rh6BG406800
rosa_wichuraiana Rw6G034870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 275
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
BbvCI CCTCAGC 1 cut(s) 125
BccI CCATC 2 cut(s) 89, 185
BglII AGATCT 1 cut(s) 172
Bpu10I CCTNAGC 1 cut(s) 125
Bse3DI GCAATG 1 cut(s) 96
BseGI GGATG 1 cut(s) 100
BseMI GCAATG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 116
Bsp143I GATC 2 cut(s) 18, 172
BspCNI CTCAG 1 cut(s) 117
BsrDI GCAATG 1 cut(s) 96
BssMI GATC 2 cut(s) 18, 172
Bst4CI ACNGT 1 cut(s) 261
BstDEI CTNAG 1 cut(s) 125
BstF5I GGATG 1 cut(s) 100
BstKTI GATC 2 cut(s) 21, 175
BstMBI GATC 2 cut(s) 18, 172
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BtsCI GGATG 1 cut(s) 100
BtsIMutI CAGTG 1 cut(s) 266
CseI GACGC 1 cut(s) 286
CviAII CATG 1 cut(s) 205
CviJI RGCY 1 cut(s) 124
CviKI_1 RGCY 1 cut(s) 124
DdeI CTNAG 1 cut(s) 125
DpnI GATC 2 cut(s) 20, 174
DpnII GATC 2 cut(s) 18, 172
Eco32I GATATC 2 cut(s) 154, 242
Eco57I CTGAAG 1 cut(s) 275
EcoRV GATATC 2 cut(s) 154, 242
FaeI CATG 1 cut(s) 208
FatI CATG 1 cut(s) 204
FokI GGATG 1 cut(s) 107
HgaI GACGC 1 cut(s) 286
Hin1II CATG 1 cut(s) 208
HinfI GANTC 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 2 cut(s) 170, 294
Hpy8I GTNNAC 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 261
HpyCH4V TGCA 2 cut(s) 31, 302
HpyF3I CTNAG 1 cut(s) 125
Hsp92II CATG 1 cut(s) 208
Kzo9I GATC 2 cut(s) 18, 172
LpnPI CCDG 2 cut(s) 153, 221
MalI GATC 2 cut(s) 20, 174
MboI GATC 2 cut(s) 18, 172
MboII GAAGA 1 cut(s) 281
MflI RGATCY 1 cut(s) 172
MluCI AATT 3 cut(s) 144, 181, 231
MnlI CCTC 2 cut(s) 111, 120
MseI TTAA 2 cut(s) 134, 267
MslI CAYNNNNRTG 1 cut(s) 26
NdeII GATC 2 cut(s) 18, 172
NlaIII CATG 1 cut(s) 208
PcsI WCGNNNNNNNCGW 1 cut(s) 280
PfeI GAWTC 1 cut(s) 74
PsuI RGATCY 1 cut(s) 172
RseI CAYNNNNRTG 1 cut(s) 26
SaqAI TTAA 2 cut(s) 134, 267
Sau3AI GATC 2 cut(s) 18, 172
SetI ASST 2 cut(s) 62, 126
SgeI CNNG 8 cut(s) 22, 28, 63, 98, 152, 209, 217, 248
SmiMI CAYNNNNRTG 1 cut(s) 26
Sse9I AATT 3 cut(s) 144, 181, 231
TaaI ACNGT 1 cut(s) 261
TaqI TCGA 1 cut(s) 283
TasI AATT 3 cut(s) 144, 181, 231
TfiI GAWTC 1 cut(s) 74
Tru1I TTAA 2 cut(s) 134, 267
Tru9I TTAA 2 cut(s) 134, 267
TscAI CASTG 1 cut(s) 266
TspDTI ATGAA 1 cut(s) 175
TspGWI ACGGA 1 cut(s) 289
TspRI CASTG 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.