AT5G18150

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
5999806 .. 6000554
749 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G18150.1

Sequence Viewer

Length: 231 bp
ATGTGTCCGATGAGGTTCTTATTGGTGTTCTTCTCAGCTGTACTCGCCGGATATTTCGCATGGAAGACGGTGAGTTCTTCGCCGGAATTCGATTCACCGGACGAATTGAATGAGAAACAAGAACTCAATCTCAAAAAGAAGATGGAGAATGGGTTTTGGGTGTTCGTCGATATGGCTAGCGGAAGATACCTTTGGAGGAATCTCAAGGAAATGAGAGAGAAATCTCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

9.03

Weight (kDa)

7.85

Isoelectric Point (pI)

40.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015901)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 180
AcsI RAATTY 1 cut(s) 86
AfaI GTAC 1 cut(s) 42
AgsI TTSAA 1 cut(s) 109
AjuI GAANNNNNNNTTGG 2 cut(s) 175, 207
AluBI AGCT 1 cut(s) 38
AluI AGCT 1 cut(s) 38
ApoI RAATTY 1 cut(s) 86
AsuHPI GGTGA 2 cut(s) 82, 87
AsuNHI GCTAGC 1 cut(s) 176
BbsI GAAGAC 1 cut(s) 71
BccI CCATC 1 cut(s) 136
BfaI CTAG 1 cut(s) 177
BmtI GCTAGC 1 cut(s) 180
BpiI GAAGAC 1 cut(s) 71
BpuEI CTTGAG 1 cut(s) 188
BsaWI WCCGGW 1 cut(s) 97
BsaXI ACNNNNNCTCC 2 cut(s) 137, 167
BseMII CTCAG 1 cut(s) 48
BsiSI CCGG 3 cut(s) 48, 83, 98
BspACI CCGC 1 cut(s) 180
BspCNI CTCAG 1 cut(s) 47
BspOI GCTAGC 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 70
BstC8I GCNNGC 1 cut(s) 178
BstDEI CTNAG 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 44
BstV2I GAAGAC 1 cut(s) 71
Cac8I GCNNGC 1 cut(s) 178
Csp6I GTAC 1 cut(s) 41
CviAII CATG 1 cut(s) 60
CviJI RGCY 2 cut(s) 38, 176
CviKI_1 RGCY 2 cut(s) 38, 176
CviQI GTAC 1 cut(s) 41
DdeI CTNAG 1 cut(s) 34
EcoRI GAATTC 1 cut(s) 86
FaeI CATG 1 cut(s) 63
FaiI YATR 2 cut(s) 61, 173
FatI CATG 1 cut(s) 59
FspBI CTAG 1 cut(s) 177
HapII CCGG 3 cut(s) 48, 83, 98
Hin1II CATG 1 cut(s) 63
HinfI GANTC 2 cut(s) 92, 199
HpaII CCGG 3 cut(s) 48, 83, 98
HphI GGTGA 2 cut(s) 82, 87
Hpy188I TCNGA 1 cut(s) 9
Hpy99I CGWCG 1 cut(s) 170
HpyCH4III ACNGT 1 cut(s) 70
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 34
Hsp92II CATG 1 cut(s) 63
LpnPI CCDG 3 cut(s) 61, 96, 111
MaeI CTAG 1 cut(s) 177
MboII GAAGA 5 cut(s) 22, 69, 76, 151, 195
MluCI AATT 2 cut(s) 86, 104
MnlI CCTC 2 cut(s) 6, 189
MspA1I CMGCKG 1 cut(s) 38
MspI CCGG 3 cut(s) 48, 83, 98
MwoI GCNNNNNNNGC 1 cut(s) 44
NheI GCTAGC 1 cut(s) 176
NlaIII CATG 1 cut(s) 63
PfeI GAWTC 2 cut(s) 92, 199
PvuII CAGCTG 1 cut(s) 38
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
SetI ASST 3 cut(s) 17, 40, 192
SgeI CNNG 8 cut(s) 56, 60, 72, 95, 110, 131, 189, 217
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 2 cut(s) 86, 104
SsiI CCGC 1 cut(s) 180
SspMI CTAG 1 cut(s) 177
TaaI ACNGT 1 cut(s) 70
TaqI TCGA 2 cut(s) 90, 168
TasI AATT 2 cut(s) 86, 104
TatI WGTACW 1 cut(s) 40
TfiI GAWTC 2 cut(s) 92, 199
XapI RAATTY 1 cut(s) 86
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.