MD12G1003700.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0015901
Physical Location & Seq
Forward (+)
549515 .. 550423
909 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1003700.v1.1.491

Sequence Viewer

Length: 282 bp
ATGTGTCCTCTAAGGTTCATCTTGGTCTTCTTCTCAGCAATCCTTGCAGGATACTTCGCGTGGAGGACGGTTTGTTCTTCTCCCGACGGAACCGACATGATGATCTCACAGCTGGATTCTACCAACAATGAAAATGCTATAGGATCACCCAAACAAGAAGAAGATGCATTCAATTCTAAAACTATGATTCAGAGTGGCTTCTGGGTGTTTGTGGACATGGCCAGCGGGAAATACTTGTGGAGGAATTTTAAGGAGATGAACCAAGTCAAAGTAAAATGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.62

Weight (kDa)

6.13

Isoelectric Point (pI)

39.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015901)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G14602 AT5G18150
malus_domestica MD12G1003700.v1.1 MD12G1185100.v1.1 MD14G1002600.v1.1
prunus_persica Prupe.6G290500_v2.0.a1 Prupe.7G004200_v2.0.a1
pyrus_communis pycom14g00030
rosa_chinensis RchiOBHm_Chr3g0460941
rosa_roxburghii Rroxscaffold_6G00419020
rosa_rugosa Rorug03G0047100
rosa_samantha Rh3BG108400 Rh3DG110200
rosa_wichuraiana Rw3G008910 Rw5G044920

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 59
AciI CCGC 1 cut(s) 225
AclWI GGATC 1 cut(s) 151
AcoI YGGCCR 1 cut(s) 219
AcsI RAATTY 1 cut(s) 244
AgsI TTSAA 1 cut(s) 172
AloI GAACNNNNNNTCC 2 cut(s) 58, 90
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
AlwI GGATC 1 cut(s) 151
AoxI GGCC 1 cut(s) 219
ApoI RAATTY 1 cut(s) 244
AsuHPI GGTGA 1 cut(s) 138
BalI TGGCCA 1 cut(s) 221
BbsI GAAGAC 1 cut(s) 19
BciVI GTATCC 1 cut(s) 44
BfmI CTRYAG 1 cut(s) 138
BfuI GTATCC 1 cut(s) 44
BmiI GGNNCC 1 cut(s) 91
BmsI GCATC 1 cut(s) 154
BpiI GAAGAC 1 cut(s) 19
BseMII CTCAG 1 cut(s) 48
Bsh1236I CGCG 1 cut(s) 59
BshFI GGCC 1 cut(s) 221
BsmI GAATGC 1 cut(s) 167
BsnI GGCC 1 cut(s) 221
Bsp143I GATC 2 cut(s) 102, 143
BspACI CCGC 1 cut(s) 225
BspANI GGCC 1 cut(s) 221
BspCNI CTCAG 1 cut(s) 47
BspFNI CGCG 1 cut(s) 59
BspLI GGNNCC 1 cut(s) 91
BspPI GGATC 1 cut(s) 151
BssMI GATC 2 cut(s) 102, 143
Bst4CI ACNGT 1 cut(s) 70
BstAPI GCANNNNNTGC 1 cut(s) 44
BstC8I GCNNGC 1 cut(s) 223
BstDEI CTNAG 2 cut(s) 11, 34
BstFNI CGCG 1 cut(s) 59
BstKTI GATC 2 cut(s) 105, 146
BstMBI GATC 2 cut(s) 102, 143
BstMWI GCNNNNNNNGC 1 cut(s) 44
BstSFI CTRYAG 1 cut(s) 138
BstUI CGCG 1 cut(s) 59
BstV2I GAAGAC 1 cut(s) 19
BsuI GTATCC 1 cut(s) 44
BsuRI GGCC 1 cut(s) 221
Cac8I GCNNGC 1 cut(s) 223
CviAII CATG 2 cut(s) 97, 217
CviJI RGCY 3 cut(s) 112, 198, 221
CviKI_1 RGCY 3 cut(s) 112, 198, 221
DdeI CTNAG 2 cut(s) 11, 34
DpnI GATC 2 cut(s) 104, 145
DpnII GATC 2 cut(s) 102, 143
EaeI YGGCCR 1 cut(s) 219
EcoT22I ATGCAT 1 cut(s) 169
FaeI CATG 2 cut(s) 100, 220
FaiI YATR 4 cut(s) 98, 140, 185, 218
FatI CATG 2 cut(s) 96, 216
FauI CCCGC 1 cut(s) 218
HaeIII GGCC 1 cut(s) 221
Hin1II CATG 2 cut(s) 100, 220
HinfI GANTC 2 cut(s) 116, 187
HphI GGTGA 1 cut(s) 138
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 1 cut(s) 192
Hpy188III TCNNGA 1 cut(s) 83
Hpy8I GTNNAC 1 cut(s) 214
Hpy99I CGWCG 1 cut(s) 89
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4V TGCA 2 cut(s) 47, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
HpyF3I CTNAG 2 cut(s) 11, 34
Hsp92II CATG 2 cut(s) 100, 220
Kzo9I GATC 2 cut(s) 102, 143
LpnPI CCDG 4 cut(s) 33, 98, 187, 235
LweI GCATC 1 cut(s) 154
MalI GATC 2 cut(s) 104, 145
MboI GATC 2 cut(s) 102, 143
MboII GAAGA 5 cut(s) 19, 22, 69, 170, 173
MlsI TGGCCA 1 cut(s) 221
MluCI AATT 2 cut(s) 172, 244
MluNI TGGCCA 1 cut(s) 221
MnlI CCTC 3 cut(s) 18, 57, 234
Mox20I TGGCCA 1 cut(s) 221
Mph1103I ATGCAT 1 cut(s) 169
MscI TGGCCA 1 cut(s) 221
MseI TTAA 1 cut(s) 249
Msp20I TGGCCA 1 cut(s) 221
MspA1I CMGCKG 2 cut(s) 112, 225
Mva1269I GAATGC 1 cut(s) 167
MvnI CGCG 1 cut(s) 59
MwoI GCNNNNNNNGC 1 cut(s) 44
NdeII GATC 2 cut(s) 102, 143
NlaIII CATG 2 cut(s) 100, 220
NlaIV GGNNCC 1 cut(s) 91
NsiI ATGCAT 1 cut(s) 169
PctI GAATGC 1 cut(s) 167
PfeI GAWTC 2 cut(s) 116, 187
PspN4I GGNNCC 1 cut(s) 91
PvuII CAGCTG 1 cut(s) 112
SaqAI TTAA 1 cut(s) 249
Sau3AI GATC 2 cut(s) 102, 143
SetI ASST 2 cut(s) 17, 114
SfaNI GCATC 1 cut(s) 154
SfcI CTRYAG 1 cut(s) 138
Sse9I AATT 2 cut(s) 172, 244
SsiI CCGC 1 cut(s) 225
TaaI ACNGT 1 cut(s) 70
TasI AATT 2 cut(s) 172, 244
TfiI GAWTC 2 cut(s) 116, 187
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TspDTI ATGAA 3 cut(s) 7, 144, 272
TspGWI ACGGA 1 cut(s) 102
XapI RAATTY 1 cut(s) 244
Zsp2I ATGCAT 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.