Rh3BG108400

expressed protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
8729042 .. 8729311
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG108400.1

Sequence Viewer

Length: 270 bp
ATGTGTCCCCTACGGTTCATATTGATACTCTTGTCTACCACGCTTGCCGGTTTCTTCTTGTTGAGAAACATCGCCTCGGAAAATGACTCGGAGATATGCGCACATTCTAATAATGGTCTTCAAGAACCAGATGCATCATCATCCCCCTCCTTCTCATGCAAGGTTGCATCTGCTATGAGATCTGCGTTTTGGACAAGCGTTGACATGGCAAGTGGACGCTACCTATGGAGAACTTTGGTGTCTTCTTCGGCTTCTGTCCATTCTCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.68

Weight (kDa)

6.8

Isoelectric Point (pI)

62.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015901)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 100
AccI GTMKAC 1 cut(s) 35
AgsI TTSAA 1 cut(s) 122
AspLEI GCGC 1 cut(s) 101
BaeI ACNNNNGTAYC 2 cut(s) 17, 50
BbsI GAAGAC 2 cut(s) 110, 234
BfaI CTAG 1 cut(s) 268
BglII AGATCT 1 cut(s) 179
BmsI GCATC 3 cut(s) 121, 143, 176
BpiI GAAGAC 2 cut(s) 110, 234
BsaJI CCNNGG 1 cut(s) 75
Bse118I RCCGGY 1 cut(s) 47
BseDI CCNNGG 1 cut(s) 75
BseGI GGATG 1 cut(s) 140
BsiSI CCGG 1 cut(s) 48
Bsp143I GATC 1 cut(s) 179
BsrFI RCCGGY 1 cut(s) 47
BssAI RCCGGY 1 cut(s) 47
BssECI CCNNGG 1 cut(s) 75
BssMI GATC 1 cut(s) 179
Bst4CI ACNGT 1 cut(s) 15
BstC8I GCNNGC 1 cut(s) 45
BstF5I GGATG 1 cut(s) 140
BstHHI GCGC 1 cut(s) 101
BstKTI GATC 1 cut(s) 182
BstMBI GATC 1 cut(s) 179
BstV2I GAAGAC 2 cut(s) 110, 234
BstX2I RGATCY 1 cut(s) 179
BstYI RGATCY 1 cut(s) 179
BtgZI GCGATG 1 cut(s) 55
BtsCI GGATG 1 cut(s) 140
Cac8I GCNNGC 1 cut(s) 45
CfoI GCGC 1 cut(s) 101
Cfr10I RCCGGY 1 cut(s) 47
CseI GACGC 1 cut(s) 225
CviAII CATG 2 cut(s) 156, 205
CviJI RGCY 1 cut(s) 251
CviKI_1 RGCY 1 cut(s) 251
DpnI GATC 1 cut(s) 181
DpnII GATC 1 cut(s) 179
EcoT22I ATGCAT 1 cut(s) 136
FaeI CATG 2 cut(s) 159, 208
FaiI YATR 6 cut(s) 20, 97, 157, 176, 206, 226
FatI CATG 2 cut(s) 155, 204
FblI GTMKAC 1 cut(s) 35
FokI GGATG 1 cut(s) 127
FspAI RTGCGCAY 1 cut(s) 100
FspBI CTAG 1 cut(s) 268
FspI TGCGCA 1 cut(s) 100
GlaI GCGC 1 cut(s) 100
HapII CCGG 1 cut(s) 48
HgaI GACGC 1 cut(s) 225
HhaI GCGC 1 cut(s) 101
Hin1II CATG 2 cut(s) 159, 208
Hin6I GCGC 1 cut(s) 99
HinP1I GCGC 1 cut(s) 99
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HinfI GANTC 1 cut(s) 86
HpaII CCGG 1 cut(s) 48
Hpy166II GTNNAC 3 cut(s) 36, 202, 215
Hpy188I TCNGA 2 cut(s) 79, 91
Hpy188III TCNNGA 1 cut(s) 122
Hpy8I GTNNAC 3 cut(s) 36, 202, 215
HpyAV CCTTC 1 cut(s) 160
HpyCH4III ACNGT 1 cut(s) 15
HpyCH4V TGCA 3 cut(s) 134, 159, 167
Hsp92II CATG 2 cut(s) 159, 208
HspAI GCGC 1 cut(s) 99
Kzo9I GATC 1 cut(s) 179
LpnPI CCDG 2 cut(s) 61, 141
LweI GCATC 3 cut(s) 121, 143, 176
MaeI CTAG 1 cut(s) 268
MalI GATC 1 cut(s) 181
MboI GATC 1 cut(s) 179
MboII GAAGA 4 cut(s) 46, 110, 234, 237
MflI RGATCY 1 cut(s) 179
MlyI GAGTC 1 cut(s) 80
MnlI CCTC 2 cut(s) 85, 157
Mph1103I ATGCAT 1 cut(s) 136
MspI CCGG 1 cut(s) 48
NdeII GATC 1 cut(s) 179
NlaIII CATG 2 cut(s) 159, 208
NsbI TGCGCA 1 cut(s) 100
NsiI ATGCAT 1 cut(s) 136
PleI GAGTC 1 cut(s) 80
PpsI GAGTC 1 cut(s) 80
PsuI RGATCY 1 cut(s) 179
Sau3AI GATC 1 cut(s) 179
SchI GAGTC 1 cut(s) 80
SetI ASST 2 cut(s) 165, 225
SfaNI GCATC 3 cut(s) 121, 143, 176
SspMI CTAG 1 cut(s) 268
TaaI ACNGT 1 cut(s) 15
TspDTI ATGAA 1 cut(s) 7
XmiI GTMKAC 1 cut(s) 35
XspI CTAG 1 cut(s) 268
Zsp2I ATGCAT 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.