FvH4_2g02300

Auxin-induced protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0017956
Physical Location & Seq
Reverse (-)
1908103 .. 1908972
870 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g02300.t1

Sequence Viewer

Length: 309 bp
ATGGGTATCAAATTGATGGGTATAGCTCATGCCAAGCAGAAACTCCAGCGAACGCTTTCAGCCAGATTAGGAGCTATCACAGACACTAATGGTATTGATGTTCCGAAAGGCCATTTCGCTGTTTATGTTGGAGAAGGCAAGAAGAAGAGGTTTGTGATTCCAATATCATATTTGAACCATCCTTTGTTTCTAGACTTGTTAAACAAGGCTCAAGAAGAGTTTGGATATGATCATCCTACAGGTGGTCTTATAATCCCATGCAGTGAAGACTACTTCATTACCCTAACTTCGGCTCTAAACTCCTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

103

Amino Acids

11.2

Weight (kDa)

8.76

Isoelectric Point (pI)

17.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 22 - 98 1.1e-24 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017956)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G34770
fragaria_vesca FvH4_2g02300
malus_domestica MD05G1113600.v1.1
prunus_persica Prupe.8G158000_v2.0.a1
pyrus_communis pycom05g10850
rosa_chinensis RchiOBHm_Chr6g0246051
rosa_laevigata RLG00000015272
rosa_multiflora Rmu_sc0004042.1_g000007
rosa_roxburghii Rroxscaffold_7G00214990
rosa_rugosa Rorug05G0518600
rosa_wichuraiana Rw6G002700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 251
AfiI CCNNNNNNNGG 2 cut(s) 242, 289
AgsI TTSAA 1 cut(s) 175
AluBI AGCT 2 cut(s) 26, 74
AluI AGCT 2 cut(s) 26, 74
AoxI GGCC 1 cut(s) 109
Asp700I GAANNNNTTC 1 cut(s) 55
BbsI GAAGAC 1 cut(s) 273
BccI CCATC 2 cut(s) 10, 186
BclI TGATCA 1 cut(s) 229
BfaI CTAG 1 cut(s) 191
BfmI CTRYAG 1 cut(s) 237
BpiI GAAGAC 1 cut(s) 273
BpmI CTGGAG 1 cut(s) 29
BpuEI CTTGAG 1 cut(s) 195
Bsc4I CCNNNNNNNGG 2 cut(s) 242, 289
BseGI GGATG 2 cut(s) 178, 232
BseLI CCNNNNNNNGG 2 cut(s) 242, 289
BseRI GAGGAG 1 cut(s) 292
BshFI GGCC 1 cut(s) 111
BslI CCNNNNNNNGG 2 cut(s) 242, 289
BsnI GGCC 1 cut(s) 111
Bsp143I GATC 1 cut(s) 229
BspANI GGCC 1 cut(s) 111
BspHI TCATGA 1 cut(s) 305
BssMI GATC 1 cut(s) 229
Bst6I CTCTTC 2 cut(s) 140, 210
BstF5I GGATG 2 cut(s) 178, 232
BstKTI GATC 1 cut(s) 232
BstMBI GATC 1 cut(s) 229
BstSFI CTRYAG 1 cut(s) 237
BstV2I GAAGAC 1 cut(s) 273
BsuRI GGCC 1 cut(s) 111
BtsCI GGATG 2 cut(s) 178, 232
BtsI GCAGTG 1 cut(s) 268
BtsIMutI CAGTG 1 cut(s) 268
CciI TCATGA 1 cut(s) 305
CviAII CATG 3 cut(s) 29, 258, 306
CviJI RGCY 6 cut(s) 26, 62, 74, 111, 209, 293
CviKI_1 RGCY 6 cut(s) 26, 62, 74, 111, 209, 293
DpnI GATC 1 cut(s) 231
DpnII GATC 1 cut(s) 229
Eam1104I CTCTTC 2 cut(s) 140, 210
EarI CTCTTC 2 cut(s) 140, 210
FaeI CATG 3 cut(s) 32, 261, 309
FaiI YATR 8 cut(s) 23, 30, 126, 169, 228, 251, 259, 307
FatI CATG 3 cut(s) 28, 257, 305
FbaI TGATCA 1 cut(s) 229
FokI GGATG 2 cut(s) 165, 219
FspBI CTAG 1 cut(s) 191
GsuI CTGGAG 1 cut(s) 29
HaeIII GGCC 1 cut(s) 111
Hin1II CATG 3 cut(s) 32, 261, 309
HinfI GANTC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 105
Hpy188III TCNNGA 3 cut(s) 191, 212, 306
HpyAV CCTTC 1 cut(s) 128
HpyCH4V TGCA 1 cut(s) 261
Hsp92II CATG 3 cut(s) 32, 261, 309
Ksp22I TGATCA 1 cut(s) 229
Kzo9I GATC 1 cut(s) 229
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 3 cut(s) 59, 76, 225
MaeI CTAG 1 cut(s) 191
MalI GATC 1 cut(s) 231
MboI GATC 1 cut(s) 229
MboII GAAGA 4 cut(s) 154, 157, 227, 278
MluCI AATT 1 cut(s) 11
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 1 cut(s) 141
MroXI GAANNNNTTC 1 cut(s) 55
MseI TTAA 1 cut(s) 200
NdeII GATC 1 cut(s) 229
NlaIII CATG 3 cut(s) 32, 261, 309
PagI TCATGA 1 cut(s) 305
PdmI GAANNNNTTC 1 cut(s) 55
PfeI GAWTC 1 cut(s) 157
PsiI TTATAA 1 cut(s) 251
SaqAI TTAA 1 cut(s) 200
Sau3AI GATC 1 cut(s) 229
SetI ASST 4 cut(s) 28, 76, 152, 244
SfcI CTRYAG 1 cut(s) 237
SmlI CTYRAG 1 cut(s) 210
SmoI CTYRAG 1 cut(s) 210
Sse9I AATT 1 cut(s) 11
SspMI CTAG 1 cut(s) 191
TasI AATT 1 cut(s) 11
TfiI GAWTC 1 cut(s) 157
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TscAI CASTG 1 cut(s) 268
TspDTI ATGAA 1 cut(s) 265
TspRI CASTG 1 cut(s) 268
XbaI TCTAGA 1 cut(s) 190
XmnI GAANNNNTTC 1 cut(s) 55
XspI CTAG 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.