Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb3

Orthogroup ID

OG0012933

Physical Location & Seq

Genomic Coordinates Forward (+)

28397397 .. 28398310

Gene Structure 914 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_3g33040.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 294 bp

ATGCAGTCCATGCTGAACCTCCATGGCACCTTTGGCCTTCCTCTCTGCGTTTCAGGGATAACTCATCATCATCCTCCTCATCTCACCCACGAGATGGCGGATCATGATCGGAGAAGGGAGGCCATGAAAAAGCAGAGATCGAGAGCTAGAGAGGAGCTGAATGCGAATCGGGAAATGGGTGCTGAGAGGATCAGAGAACGAGTGACTGAAGAGATCATAGATGGTGATCTAGCTGCTCTACTGCGTGATCTGTCCCTTTGTTATTTGGCTAATTGTATTGCTAAAGCTGCTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

98

Amino Acids

11.04

Weight (kDa)

7.06

Isoelectric Point (pI)

46.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012933)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G60400 AT5G60400 AT5G60400
fragaria_vesca	FvH4_3g33040
malus_domestica	MD03G1112500.v1.1 MD11G1131400.v1.1
prunus_persica	Prupe.6G095800_v2.0.a1 Prupe.6G096000_v2.0.a1
pyrus_communis	pycom11g10860
rosa_chinensis	RchiOBHm_Chr5g0060411
rosa_multiflora	Rmu_sc0003270.1_g000013
rosa_roxburghii	Rroxscaffold_1G00020420
rosa_rugosa	Rorug05G0329700
rosa_samantha	Rh5AG394400 Rh5BG406600 Rh5CG430400 Rh5DG421700
rosa_wichuraiana	Rw5G037100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	26
AccB7I	CCANNNNNTGG	1 cut(s)	94
AciI	CCGC	1 cut(s)	98
AclWI	GGATC	2 cut(s)	108, 197
AcuI	CTGAAG	1 cut(s)	228
AfiI	CCNNNNNNNGG	1 cut(s)	94
AluBI	AGCT	4 cut(s)	146, 157, 233, 287
AluI	AGCT	4 cut(s)	146, 157, 233, 287
AlwI	GGATC	2 cut(s)	108, 197
AoxI	GGCC	2 cut(s)	34, 120
ApeKI	GCWGC	2 cut(s)	233, 287
AsuHPI	GGTGA	2 cut(s)	76, 236
BanI	GGYRCC	1 cut(s)	26
BauI	CACGAG	1 cut(s)	89
BbvI	GCAGC	2 cut(s)	220, 274
BccI	CCATC	2 cut(s)	88, 215
BfaI	CTAG	2 cut(s)	147, 230
BisI	GCNGC	2 cut(s)	234, 288
BlsI	GCNGC	2 cut(s)	235, 289
BmiI	GGNNCC	1 cut(s)	28
BsaBI	GATNNNNATC	2 cut(s)	105, 225
BsaJI	CCNNGG	1 cut(s)	22
Bsc4I	CCNNNNNNNGG	1 cut(s)	94
Bse8I	GATNNNNATC	2 cut(s)	105, 225
BseDI	CCNNGG	1 cut(s)	22
BseGI	GGATG	1 cut(s)	70
BseJI	GATNNNNATC	2 cut(s)	105, 225
BseLI	CCNNNNNNNGG	1 cut(s)	94
BseMII	CTCAG	1 cut(s)	174
BseRI	GAGGAG	2 cut(s)	66, 167
BseXI	GCAGC	2 cut(s)	220, 274
BshFI	GGCC	2 cut(s)	36, 122
BshNI	GGYRCC	1 cut(s)	26
BslFI	GGGAC	1 cut(s)	238
BslI	CCNNNNNNNGG	1 cut(s)	94
BsmFI	GGGAC	1 cut(s)	238
BsmI	GAATGC	1 cut(s)	166
BsnI	GGCC	2 cut(s)	36, 122
Bsp143I	GATC	7 cut(s)	100, 106, 137, 189, 213, 226, 247
Bsp19I	CCATGG	1 cut(s)	22
BspACI	CCGC	1 cut(s)	98
BspANI	GGCC	2 cut(s)	36, 122
BspCNI	CTCAG	1 cut(s)	175
BspHI	TCATGA	1 cut(s)	103
BspLI	GGNNCC	1 cut(s)	28
BspPI	GGATC	2 cut(s)	108, 197
BspT107I	GGYRCC	1 cut(s)	26
BssECI	CCNNGG	1 cut(s)	22
BssMI	GATC	7 cut(s)	100, 106, 137, 189, 213, 226, 247
BssSI	CACGAG	1 cut(s)	89
BssT1I	CCWWGG	1 cut(s)	22
Bst2BI	CACGAG	1 cut(s)	89
Bst6I	CTCTTC	1 cut(s)	204
BstAPI	GCANNNNNTGC	1 cut(s)	10
BstDEI	CTNAG	2 cut(s)	183, 291
BstDSI	CCRYGG	1 cut(s)	22
BstF5I	GGATG	1 cut(s)	70
BstKTI	GATC	7 cut(s)	103, 109, 140, 192, 216, 229, 250
BstMBI	GATC	7 cut(s)	100, 106, 137, 189, 213, 226, 247
BstMWI	GCNNNNNNNGC	3 cut(s)	10, 33, 287
BstV1I	GCAGC	2 cut(s)	220, 274
BsuRI	GGCC	2 cut(s)	36, 122
BtgI	CCRYGG	1 cut(s)	22
BtsCI	GGATG	1 cut(s)	70
CciI	TCATGA	1 cut(s)	103
CviAII	CATG	4 cut(s)	10, 23, 104, 124
CviJI	RGCY	7 cut(s)	36, 122, 146, 157, 233, 269, 287
CviKI_1	RGCY	7 cut(s)	36, 122, 146, 157, 233, 269, 287
DdeI	CTNAG	2 cut(s)	183, 291
DpnI	GATC	7 cut(s)	102, 108, 139, 191, 215, 228, 249
DpnII	GATC	7 cut(s)	100, 106, 137, 189, 213, 226, 247
Eam1104I	CTCTTC	1 cut(s)	204
EarI	CTCTTC	1 cut(s)	204
EciI	GGCGGA	1 cut(s)	113
Eco130I	CCWWGG	1 cut(s)	22
Eco57I	CTGAAG	1 cut(s)	228
EcoT14I	CCWWGG	1 cut(s)	22
ErhI	CCWWGG	1 cut(s)	22
FaeI	CATG	4 cut(s)	13, 26, 107, 127
FaiI	YATR	5 cut(s)	11, 24, 105, 125, 218
FaqI	GGGAC	1 cut(s)	238
FatI	CATG	4 cut(s)	9, 22, 103, 123
Fnu4HI	GCNGC	2 cut(s)	234, 288
FokI	GGATG	1 cut(s)	57
Fsp4HI	GCNGC	2 cut(s)	234, 288
FspBI	CTAG	2 cut(s)	147, 230
GluI	GCNGC	2 cut(s)	234, 288
HaeIII	GGCC	2 cut(s)	36, 122
Hin1II	CATG	4 cut(s)	13, 26, 107, 127
HinfI	GANTC	1 cut(s)	166
HphI	GGTGA	2 cut(s)	76, 236
Hpy188I	TCNGA	2 cut(s)	111, 194
Hpy188III	TCNNGA	3 cut(s)	104, 141, 170
HpyAV	CCTTC	2 cut(s)	47, 108
HpyCH4V	TGCA	1 cut(s)	4
HpyF10VI	GCNNNNNNNGC	3 cut(s)	10, 33, 287
HpyF3I	CTNAG	2 cut(s)	183, 291
Hsp92II	CATG	4 cut(s)	13, 26, 107, 127
Kzo9I	GATC	7 cut(s)	100, 106, 137, 189, 213, 226, 247
LmnI	GCTCC	1 cut(s)	154
LpnPI	CCDG	1 cut(s)	39
Lsp1109I	GCAGC	2 cut(s)	220, 274
MaeI	CTAG	2 cut(s)	147, 230
MaeIII	GTNAC	1 cut(s)	202
MalI	GATC	7 cut(s)	102, 108, 139, 191, 215, 228, 249
MboI	GATC	7 cut(s)	100, 106, 137, 189, 213, 226, 247
MboII	GAAGA	1 cut(s)	221
MluCI	AATT	1 cut(s)	271
MnlI	CCTC	7 cut(s)	29, 51, 84, 87, 112, 145, 180
Mva1269I	GAATGC	1 cut(s)	166
MwoI	GCNNNNNNNGC	3 cut(s)	10, 33, 287
NcoI	CCATGG	1 cut(s)	22
NdeII	GATC	7 cut(s)	100, 106, 137, 189, 213, 226, 247
NlaIII	CATG	4 cut(s)	13, 26, 107, 127
NlaIV	GGNNCC	1 cut(s)	28
NmuCI	GTSAC	1 cut(s)	202
PagI	TCATGA	1 cut(s)	103
PctI	GAATGC	1 cut(s)	166
PfeI	GAWTC	1 cut(s)	166
PflMI	CCANNNNNTGG	1 cut(s)	94
PkrI	GCNGC	2 cut(s)	235, 289
PspN4I	GGNNCC	1 cut(s)	28
SatI	GCNGC	2 cut(s)	234, 288
Sau3AI	GATC	7 cut(s)	100, 106, 137, 189, 213, 226, 247
SetI	ASST	6 cut(s)	21, 32, 148, 159, 235, 289
Sse9I	AATT	1 cut(s)	271
SsiI	CCGC	1 cut(s)	98
SspMI	CTAG	2 cut(s)	147, 230
StyI	CCWWGG	1 cut(s)	22
TaqI	TCGA	1 cut(s)	140
TasI	AATT	1 cut(s)	271
TfiI	GAWTC	1 cut(s)	166
TseFI	GTSAC	1 cut(s)	202
TseI	GCWGC	2 cut(s)	233, 287
Tsp45I	GTSAC	1 cut(s)	202
TspDTI	ATGAA	1 cut(s)	140
Van91I	CCANNNNNTGG	1 cut(s)	94
XcmI	CCANNNNNNNNNTGG	1 cut(s)	29
XspI	CTAG	2 cut(s)	147, 230

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.