MD11G1131400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0012933
Physical Location & Seq
Reverse (-)
11888719 .. 11889701
983 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1131400.v1.1.491

Sequence Viewer

Length: 303 bp
ATGCAGTCCATGTTAAACCTCCATGGCAGTTTTGGCCTTCCTCTCTGTGTTTCAGGGATAACCCATCACCATCTCACCTTTTCTAAGGAGATGGTAGATCATGATCGCAGGAGGGAAGCCATGAGAAGGAAGAGATCACAAGCTAGGGCAGCTCTGCATGCAAATCAAGAAGTGGGTTTTGAAGTTAGAAGTGAAAGAGTTGCAGAAGAAGAGATCAAGTTTGATGATGATGATGGAGATCTAGCTACAGCACTACATGATCTGCGTTGCAGTTATTTGGCTTGTACTGCAAAAGCTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.31

Weight (kDa)

6.36

Isoelectric Point (pI)

62.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012933)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G60400 AT5G60400 AT5G60400
fragaria_vesca FvH4_3g33040
malus_domestica MD03G1112500.v1.1 MD11G1131400.v1.1
prunus_persica Prupe.6G095800_v2.0.a1 Prupe.6G096000_v2.0.a1
pyrus_communis pycom11g10860
rosa_chinensis RchiOBHm_Chr5g0060411
rosa_multiflora Rmu_sc0003270.1_g000013
rosa_roxburghii Rroxscaffold_1G00020420
rosa_rugosa Rorug05G0329700
rosa_samantha Rh5AG394400 Rh5BG406600 Rh5CG430400 Rh5DG421700
rosa_wichuraiana Rw5G037100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 286
AfiI CCNNNNNNNGG 1 cut(s) 126
AgsI TTSAA 1 cut(s) 182
AluBI AGCT 4 cut(s) 143, 152, 245, 296
AluI AGCT 4 cut(s) 143, 152, 245, 296
AoxI GGCC 1 cut(s) 34
ApeKI GCWGC 2 cut(s) 149, 296
AsuHPI GGTGA 2 cut(s) 59, 67
BbvI GCAGC 2 cut(s) 161, 283
BccI CCATC 4 cut(s) 72, 78, 85, 227
BfaI CTAG 2 cut(s) 144, 242
BfmI CTRYAG 1 cut(s) 246
BglII AGATCT 1 cut(s) 238
BisI GCNGC 2 cut(s) 150, 297
BlsI GCNGC 2 cut(s) 151, 298
BsaBI GATNNNNATC 2 cut(s) 102, 237
BsaJI CCNNGG 1 cut(s) 22
Bsc4I CCNNNNNNNGG 1 cut(s) 126
Bse8I GATNNNNATC 2 cut(s) 102, 237
BseDI CCNNGG 1 cut(s) 22
BseJI GATNNNNATC 2 cut(s) 102, 237
BseLI CCNNNNNNNGG 1 cut(s) 126
BseXI GCAGC 2 cut(s) 161, 283
BshFI GGCC 1 cut(s) 36
BslI CCNNNNNNNGG 1 cut(s) 126
BsnI GGCC 1 cut(s) 36
Bsp143I GATC 6 cut(s) 97, 103, 134, 213, 238, 259
Bsp19I CCATGG 1 cut(s) 22
BspANI GGCC 1 cut(s) 36
BspHI TCATGA 1 cut(s) 100
BssECI CCNNGG 1 cut(s) 22
BssMI GATC 6 cut(s) 97, 103, 134, 213, 238, 259
BssT1I CCWWGG 1 cut(s) 22
Bst6I CTCTTC 2 cut(s) 125, 204
BstAPI GCANNNNNTGC 1 cut(s) 296
BstC8I GCNNGC 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 84
BstDSI CCRYGG 1 cut(s) 22
BstKTI GATC 6 cut(s) 100, 106, 137, 216, 241, 262
BstMBI GATC 6 cut(s) 97, 103, 134, 213, 238, 259
BstMWI GCNNNNNNNGC 5 cut(s) 33, 149, 158, 287, 296
BstNSI RCATGY 1 cut(s) 161
BstSFI CTRYAG 1 cut(s) 246
BstV1I GCAGC 2 cut(s) 161, 283
BstX2I RGATCY 1 cut(s) 238
BstYI RGATCY 1 cut(s) 238
BsuRI GGCC 1 cut(s) 36
BtgI CCRYGG 1 cut(s) 22
Cac8I GCNNGC 1 cut(s) 159
CciI TCATGA 1 cut(s) 100
Csp6I GTAC 1 cut(s) 285
CviAII CATG 6 cut(s) 10, 23, 101, 121, 158, 257
CviJI RGCY 7 cut(s) 36, 119, 143, 152, 245, 281, 296
CviKI_1 RGCY 7 cut(s) 36, 119, 143, 152, 245, 281, 296
CviQI GTAC 1 cut(s) 285
DdeI CTNAG 1 cut(s) 84
DpnI GATC 6 cut(s) 99, 105, 136, 215, 240, 261
DpnII GATC 6 cut(s) 97, 103, 134, 213, 238, 259
Eam1104I CTCTTC 2 cut(s) 125, 204
EarI CTCTTC 2 cut(s) 125, 204
Eco130I CCWWGG 1 cut(s) 22
EcoT14I CCWWGG 1 cut(s) 22
ErhI CCWWGG 1 cut(s) 22
FaeI CATG 6 cut(s) 13, 26, 104, 124, 161, 260
FaiI YATR 7 cut(s) 11, 24, 102, 122, 159, 258, 301
FatI CATG 6 cut(s) 9, 22, 100, 120, 157, 256
Fnu4HI GCNGC 2 cut(s) 150, 297
Fsp4HI GCNGC 2 cut(s) 150, 297
FspBI CTAG 2 cut(s) 144, 242
GluI GCNGC 2 cut(s) 150, 297
HaeIII GGCC 1 cut(s) 36
Hin1II CATG 6 cut(s) 13, 26, 104, 124, 161, 260
HphI GGTGA 2 cut(s) 59, 67
Hpy188III TCNNGA 2 cut(s) 101, 167
HpyAV CCTTC 2 cut(s) 47, 120
HpyCH4V TGCA 7 cut(s) 4, 157, 161, 203, 270, 290, 299
HpyF10VI GCNNNNNNNGC 5 cut(s) 33, 149, 158, 287, 296
HpyF3I CTNAG 1 cut(s) 84
Hsp92II CATG 6 cut(s) 13, 26, 104, 124, 161, 260
Kzo9I GATC 6 cut(s) 97, 103, 134, 213, 238, 259
LpnPI CCDG 2 cut(s) 39, 94
Lsp1109I GCAGC 2 cut(s) 161, 283
MaeI CTAG 2 cut(s) 144, 242
MalI GATC 6 cut(s) 99, 105, 136, 215, 240, 261
MboI GATC 6 cut(s) 97, 103, 134, 213, 238, 259
MboII GAAGA 3 cut(s) 142, 218, 221
MflI RGATCY 1 cut(s) 238
MnlI CCTC 3 cut(s) 29, 51, 105
MseI TTAA 1 cut(s) 14
MwoI GCNNNNNNNGC 5 cut(s) 33, 149, 158, 287, 296
NcoI CCATGG 1 cut(s) 22
NdeII GATC 6 cut(s) 97, 103, 134, 213, 238, 259
NlaIII CATG 6 cut(s) 13, 26, 104, 124, 161, 260
NspI RCATGY 1 cut(s) 161
PaeI GCATGC 1 cut(s) 161
PagI TCATGA 1 cut(s) 100
PkrI GCNGC 2 cut(s) 151, 298
PsuI RGATCY 1 cut(s) 238
RsaI GTAC 1 cut(s) 286
RsaNI GTAC 1 cut(s) 285
SaqAI TTAA 1 cut(s) 14
SatI GCNGC 2 cut(s) 150, 297
Sau3AI GATC 6 cut(s) 97, 103, 134, 213, 238, 259
SetI ASST 6 cut(s) 21, 80, 145, 154, 247, 298
SfcI CTRYAG 1 cut(s) 246
SphI GCATGC 1 cut(s) 161
SspMI CTAG 2 cut(s) 144, 242
StyI CCWWGG 1 cut(s) 22
TatI WGTACW 1 cut(s) 284
Tru1I TTAA 1 cut(s) 14
Tru9I TTAA 1 cut(s) 14
TseI GCWGC 2 cut(s) 149, 296
XceI RCATGY 1 cut(s) 161
XcmI CCANNNNNNNNNTGG 1 cut(s) 29
XspI CTAG 2 cut(s) 144, 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.