Prupe.6G096000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Reverse (-)
6653881 .. 6654243
363 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G096000.1

Sequence Viewer

Length: 243 bp
ATAACCCATCATCATCTCACCTTCTCTAAGGAGATGGCAGATCATGATCGCAAAAGGGAGGCCATGAAAAGGCAGAGATCACAAGCCAGAGCAGAGCTGCATACAAATCAAGAACTGGGTTTTGAGAGAAGCAGCGGAAGCGTGGGAGACAAGAACATGGAAGGTGGGGTTGATGAAGATCTAGCTAGTGTGCTACATGATATGTGTTGCAGTTATTTGGCTTGTACTGCAAAAGTTGCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.97

Weight (kDa)

6.3

Isoelectric Point (pI)

44.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012933)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 135
AfaI GTAC 1 cut(s) 226
AfiI CCNNNNNNNGG 1 cut(s) 69
AluBI AGCT 2 cut(s) 97, 185
AluI AGCT 2 cut(s) 97, 185
Alw26I GTCTC 1 cut(s) 141
AoxI GGCC 1 cut(s) 60
ApeKI GCWGC 2 cut(s) 97, 132
AsuHPI GGTGA 1 cut(s) 10
BbvI GCAGC 2 cut(s) 84, 144
BccI CCATC 2 cut(s) 15, 28
BcoDI GTCTC 1 cut(s) 141
BfaI CTAG 2 cut(s) 182, 186
BglII AGATCT 1 cut(s) 178
BisI GCNGC 2 cut(s) 98, 133
BlsI GCNGC 2 cut(s) 99, 134
BmrI ACTGGG 1 cut(s) 125
BmuI ACTGGG 1 cut(s) 125
BsaBI GATNNNNATC 2 cut(s) 45, 177
Bsc4I CCNNNNNNNGG 1 cut(s) 69
Bse1I ACTGG 1 cut(s) 120
Bse8I GATNNNNATC 2 cut(s) 45, 177
BseJI GATNNNNATC 2 cut(s) 45, 177
BseLI CCNNNNNNNGG 1 cut(s) 69
BseNI ACTGG 1 cut(s) 120
BseXI GCAGC 2 cut(s) 84, 144
BshFI GGCC 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 69
BsmAI GTCTC 1 cut(s) 141
BsnI GGCC 1 cut(s) 62
Bsp143I GATC 4 cut(s) 40, 46, 77, 178
BspACI CCGC 1 cut(s) 135
BspANI GGCC 1 cut(s) 62
BspHI TCATGA 1 cut(s) 43
BsrI ACTGG 1 cut(s) 120
BssMI GATC 4 cut(s) 40, 46, 77, 178
BstAPI GCANNNNNTGC 1 cut(s) 236
BstDEI CTNAG 1 cut(s) 27
BstKTI GATC 4 cut(s) 43, 49, 80, 181
BstMAI GTCTC 1 cut(s) 141
BstMBI GATC 4 cut(s) 40, 46, 77, 178
BstMWI GCNNNNNNNGC 3 cut(s) 138, 227, 236
BstV1I GCAGC 2 cut(s) 84, 144
BstX2I RGATCY 1 cut(s) 178
BstYI RGATCY 1 cut(s) 178
BsuRI GGCC 1 cut(s) 62
CciI TCATGA 1 cut(s) 43
Csp6I GTAC 1 cut(s) 225
CviAII CATG 4 cut(s) 44, 64, 157, 197
CviJI RGCY 5 cut(s) 62, 86, 97, 185, 221
CviKI_1 RGCY 5 cut(s) 62, 86, 97, 185, 221
CviQI GTAC 1 cut(s) 225
DdeI CTNAG 1 cut(s) 27
DpnI GATC 4 cut(s) 42, 48, 79, 180
DpnII GATC 4 cut(s) 40, 46, 77, 178
FaeI CATG 4 cut(s) 47, 67, 160, 200
FaiI YATR 6 cut(s) 45, 65, 102, 158, 198, 203
FatI CATG 4 cut(s) 43, 63, 156, 196
Fnu4HI GCNGC 2 cut(s) 98, 133
Fsp4HI GCNGC 2 cut(s) 98, 133
FspBI CTAG 2 cut(s) 182, 186
GluI GCNGC 2 cut(s) 98, 133
HaeIII GGCC 1 cut(s) 62
Hin1II CATG 4 cut(s) 47, 67, 160, 200
HphI GGTGA 1 cut(s) 10
Hpy188III TCNNGA 2 cut(s) 44, 110
HpyAV CCTTC 2 cut(s) 31, 155
HpyCH4V TGCA 3 cut(s) 100, 210, 230
HpyF10VI GCNNNNNNNGC 3 cut(s) 138, 227, 236
HpyF3I CTNAG 1 cut(s) 27
Hsp92II CATG 4 cut(s) 47, 67, 160, 200
Kzo9I GATC 4 cut(s) 40, 46, 77, 178
LpnPI CCDG 2 cut(s) 100, 101
Lsp1109I GCAGC 2 cut(s) 84, 144
MaeI CTAG 2 cut(s) 182, 186
MalI GATC 4 cut(s) 42, 48, 79, 180
MboI GATC 4 cut(s) 40, 46, 77, 178
MboII GAAGA 1 cut(s) 188
MflI RGATCY 1 cut(s) 178
MnlI CCTC 1 cut(s) 52
MspA1I CMGCKG 1 cut(s) 135
MwoI GCNNNNNNNGC 3 cut(s) 138, 227, 236
NdeII GATC 4 cut(s) 40, 46, 77, 178
NlaIII CATG 4 cut(s) 47, 67, 160, 200
PagI TCATGA 1 cut(s) 43
PkrI GCNGC 2 cut(s) 99, 134
PsuI RGATCY 1 cut(s) 178
RsaI GTAC 1 cut(s) 226
RsaNI GTAC 1 cut(s) 225
SatI GCNGC 2 cut(s) 98, 133
Sau3AI GATC 4 cut(s) 40, 46, 77, 178
SetI ASST 4 cut(s) 23, 99, 166, 187
SsiI CCGC 1 cut(s) 135
SspMI CTAG 2 cut(s) 182, 186
TatI WGTACW 1 cut(s) 224
TseI GCWGC 2 cut(s) 97, 132
TspDTI ATGAA 2 cut(s) 80, 189
XspI CTAG 2 cut(s) 182, 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.