Rw5G037100

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
65399427 .. 65399803
377 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G037100.1

Sequence Viewer

Length: 291 bp
ATGCAGTCCATGTTGAACCTTCATGGCACCTTTGGCCTTCCTCTATGCGTTTCAGGGATAACTCATCATCCTCCTCATCTCACCCACGAGATGGCGGATCATGATCGGAGAAGAGAGGCCATGAAAAAGCAGAGATCGAGAGCTAGAGAGGAGCTGAATGCGAATCAGGAACTGGGTATTGACAGGATCAGAGGAAGAGTGGCGGAAGAGATCATGGATGGTGATCTAGCTGCTCTACTGCATGATCTGTCCCTTTGTTATTTGGCTAATTGTATTGCTAAAGCTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.78

Weight (kDa)

6.64

Isoelectric Point (pI)

42.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012933)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 26
AccB7I CCANNNNNTGG 1 cut(s) 91
AciI CCGC 2 cut(s) 95, 203
AclWI GGATC 2 cut(s) 105, 194
AfiI CCNNNNNNNGG 1 cut(s) 91
AgsI TTSAA 1 cut(s) 16
AluBI AGCT 4 cut(s) 143, 154, 230, 284
AluI AGCT 4 cut(s) 143, 154, 230, 284
AlwI GGATC 2 cut(s) 105, 194
AlwNI CAGNNNCTG 1 cut(s) 172
AoxI GGCC 2 cut(s) 34, 117
ApeKI GCWGC 2 cut(s) 230, 284
AsuHPI GGTGA 2 cut(s) 73, 233
BanI GGYRCC 1 cut(s) 26
BauI CACGAG 1 cut(s) 86
BbvI GCAGC 2 cut(s) 217, 271
BccI CCATC 2 cut(s) 85, 212
BfaI CTAG 2 cut(s) 144, 227
BisI GCNGC 2 cut(s) 231, 285
BlsI GCNGC 2 cut(s) 232, 286
BmiI GGNNCC 1 cut(s) 28
BmrI ACTGGG 1 cut(s) 182
BmuI ACTGGG 1 cut(s) 182
BsaBI GATNNNNATC 2 cut(s) 102, 222
Bsc4I CCNNNNNNNGG 1 cut(s) 91
Bse1I ACTGG 1 cut(s) 177
Bse8I GATNNNNATC 2 cut(s) 102, 222
BseGI GGATG 2 cut(s) 67, 223
BseJI GATNNNNATC 2 cut(s) 102, 222
BseLI CCNNNNNNNGG 1 cut(s) 91
BseNI ACTGG 1 cut(s) 177
BseRI GAGGAG 2 cut(s) 63, 164
BseXI GCAGC 2 cut(s) 217, 271
BshFI GGCC 2 cut(s) 36, 119
BshNI GGYRCC 1 cut(s) 26
BslFI GGGAC 1 cut(s) 235
BslI CCNNNNNNNGG 1 cut(s) 91
BsmFI GGGAC 1 cut(s) 235
BsmI GAATGC 1 cut(s) 163
BsnI GGCC 2 cut(s) 36, 119
Bsp143I GATC 7 cut(s) 97, 103, 134, 186, 210, 223, 244
BspACI CCGC 2 cut(s) 95, 203
BspANI GGCC 2 cut(s) 36, 119
BspHI TCATGA 1 cut(s) 100
BspLI GGNNCC 1 cut(s) 28
BspPI GGATC 2 cut(s) 105, 194
BspT107I GGYRCC 1 cut(s) 26
BsrI ACTGG 1 cut(s) 177
BssMI GATC 7 cut(s) 97, 103, 134, 186, 210, 223, 244
BssSI CACGAG 1 cut(s) 86
Bst2BI CACGAG 1 cut(s) 86
Bst6I CTCTTC 3 cut(s) 106, 190, 201
BstDEI CTNAG 1 cut(s) 288
BstF5I GGATG 2 cut(s) 67, 223
BstKTI GATC 7 cut(s) 100, 106, 137, 189, 213, 226, 247
BstMBI GATC 7 cut(s) 97, 103, 134, 186, 210, 223, 244
BstMWI GCNNNNNNNGC 2 cut(s) 33, 284
BstV1I GCAGC 2 cut(s) 217, 271
BsuRI GGCC 2 cut(s) 36, 119
BtsCI GGATG 2 cut(s) 67, 223
CaiI CAGNNNCTG 1 cut(s) 172
CciI TCATGA 1 cut(s) 100
CviAII CATG 6 cut(s) 10, 23, 101, 121, 214, 242
CviJI RGCY 7 cut(s) 36, 119, 143, 154, 230, 266, 284
CviKI_1 RGCY 7 cut(s) 36, 119, 143, 154, 230, 266, 284
DdeI CTNAG 1 cut(s) 288
DpnI GATC 7 cut(s) 99, 105, 136, 188, 212, 225, 246
DpnII GATC 7 cut(s) 97, 103, 134, 186, 210, 223, 244
Eam1104I CTCTTC 3 cut(s) 106, 190, 201
EarI CTCTTC 3 cut(s) 106, 190, 201
EciI GGCGGA 2 cut(s) 110, 218
FaeI CATG 6 cut(s) 13, 26, 104, 124, 217, 245
FaiI YATR 7 cut(s) 11, 24, 46, 102, 122, 215, 243
FaqI GGGAC 1 cut(s) 235
FatI CATG 6 cut(s) 9, 22, 100, 120, 213, 241
Fnu4HI GCNGC 2 cut(s) 231, 285
FokI GGATG 2 cut(s) 54, 230
Fsp4HI GCNGC 2 cut(s) 231, 285
FspBI CTAG 2 cut(s) 144, 227
GluI GCNGC 2 cut(s) 231, 285
HaeIII GGCC 2 cut(s) 36, 119
Hin1II CATG 6 cut(s) 13, 26, 104, 124, 217, 245
HinfI GANTC 1 cut(s) 163
HphI GGTGA 2 cut(s) 73, 233
Hpy188I TCNGA 2 cut(s) 108, 191
Hpy188III TCNNGA 3 cut(s) 101, 138, 167
HpyAV CCTTC 2 cut(s) 29, 47
HpyCH4V TGCA 2 cut(s) 4, 241
HpyF10VI GCNNNNNNNGC 2 cut(s) 33, 284
HpyF3I CTNAG 1 cut(s) 288
Hsp92II CATG 6 cut(s) 13, 26, 104, 124, 217, 245
Kzo9I GATC 7 cut(s) 97, 103, 134, 186, 210, 223, 244
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 4 cut(s) 39, 152, 158, 169
Lsp1109I GCAGC 2 cut(s) 217, 271
MaeI CTAG 2 cut(s) 144, 227
MalI GATC 7 cut(s) 99, 105, 136, 188, 212, 225, 246
MboI GATC 7 cut(s) 97, 103, 134, 186, 210, 223, 244
MboII GAAGA 3 cut(s) 123, 207, 218
MluCI AATT 1 cut(s) 268
MnlI CCTC 6 cut(s) 51, 81, 84, 109, 142, 185
Mva1269I GAATGC 1 cut(s) 163
MwoI GCNNNNNNNGC 2 cut(s) 33, 284
NdeII GATC 7 cut(s) 97, 103, 134, 186, 210, 223, 244
NlaIII CATG 6 cut(s) 13, 26, 104, 124, 217, 245
NlaIV GGNNCC 1 cut(s) 28
PagI TCATGA 1 cut(s) 100
PctI GAATGC 1 cut(s) 163
PfeI GAWTC 1 cut(s) 163
PflMI CCANNNNNTGG 1 cut(s) 91
PkrI GCNGC 2 cut(s) 232, 286
PspN4I GGNNCC 1 cut(s) 28
PstNI CAGNNNCTG 1 cut(s) 172
SatI GCNGC 2 cut(s) 231, 285
Sau3AI GATC 7 cut(s) 97, 103, 134, 186, 210, 223, 244
SetI ASST 6 cut(s) 21, 32, 145, 156, 232, 286
Sse9I AATT 1 cut(s) 268
SsiI CCGC 2 cut(s) 95, 203
SspMI CTAG 2 cut(s) 144, 227
TaqI TCGA 1 cut(s) 137
TasI AATT 1 cut(s) 268
TfiI GAWTC 1 cut(s) 163
TseI GCWGC 2 cut(s) 230, 284
TspDTI ATGAA 2 cut(s) 11, 137
Van91I CCANNNNNTGG 1 cut(s) 91
XspI CTAG 2 cut(s) 144, 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.