FvH4_5g28660

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0017198
Physical Location & Seq
Forward (+)
19844604 .. 19845999
1396 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g28660.t1

Sequence Viewer

Length: 375 bp
ATGGATGGGGGATACTCCAAGATCAATATCGATCACTCCCAAAACTCAAGATCCATGGAATTTTCAGATCTTGGATCCAAAACACAGTTAGAAAGCAATCTGCAGATGAAGAACAAGCTTGACCAGACCAGTTCCAACAAACAAGACGACGACGACGAGATTCAGCATCAAGATAGGAACTTTGGTAATGGTAATGGCAGTCATGTGGTACTGAAAAGGAACTCAGTCTCTTCTTCTTCTCCTTCTGGGTTTCAGTCTGCTGTGAAAGGAGCAATATCCTCAATGAGAAGATCCTCCTCCACAGTTTCAGAAAGGTATTCCAGGATCCATGACCAGTCTGTAACATGCGTTATTGACCTTCATGATGGTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

13.68

Weight (kDa)

5.92

Isoelectric Point (pI)

61.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017198)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G24275
fragaria_vesca FvH4_5g28660
prunus_persica Prupe.1G579700_v2.0.a1
pyrus_communis pycom08g21010
rosa_chinensis RchiOBHm_Chr7g0220641
rosa_laevigata RLG00000002213
rosa_multiflora Rmu_ssc0000189.1_g000015
rosa_rugosa Rorug07G0195400
rosa_samantha Rh7AG336600 Rh7BG327500 Rh7CG354400 Rh7DG332900
rosa_wichuraiana Rw7G028700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 6 cut(s) 45, 69, 82, 285, 319, 332
AcsI RAATTY 1 cut(s) 59
AfaI GTAC 1 cut(s) 210
AjnI CCWGG 1 cut(s) 320
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
Alw26I GTCTC 1 cut(s) 232
AlwI GGATC 6 cut(s) 45, 69, 82, 285, 319, 332
ApoI RAATTY 1 cut(s) 59
BamHI GGATCC 2 cut(s) 74, 324
BccI CCATC 1 cut(s) 359
BciT130I CCWGG 1 cut(s) 322
BciVI GTATCC 1 cut(s) 5
BcoDI GTCTC 1 cut(s) 232
BfmI CTRYAG 1 cut(s) 101
BfuI GTATCC 1 cut(s) 5
BglII AGATCT 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 322
BmiI GGNNCC 2 cut(s) 76, 326
BmrFI CCNGG 1 cut(s) 322
BmsI GCATC 1 cut(s) 175
BpuEI CTTGAG 1 cut(s) 31
Bsa29I ATCGAT 1 cut(s) 30
BsaBI GATNNNNATC 1 cut(s) 26
BsaJI CCNNGG 1 cut(s) 54
Bse1I ACTGG 2 cut(s) 129, 334
Bse8I GATNNNNATC 1 cut(s) 26
BseBI CCWGG 1 cut(s) 322
BseCI ATCGAT 1 cut(s) 30
BseDI CCNNGG 1 cut(s) 54
BseGI GGATG 1 cut(s) 10
BseJI GATNNNNATC 1 cut(s) 26
BseMII CTCAG 1 cut(s) 237
BseNI ACTGG 2 cut(s) 129, 334
BseRI GAGGAG 1 cut(s) 286
BshVI ATCGAT 1 cut(s) 30
BsmAI GTCTC 1 cut(s) 232
Bsp143I GATC 7 cut(s) 21, 31, 50, 67, 74, 290, 324
Bsp19I CCATGG 1 cut(s) 54
BspCNI CTCAG 1 cut(s) 236
BspDI ATCGAT 1 cut(s) 30
BspHI TCATGA 1 cut(s) 361
BspLI GGNNCC 2 cut(s) 76, 326
BspMAI CTGCAG 1 cut(s) 105
BspPI GGATC 6 cut(s) 45, 69, 82, 285, 319, 332
BsrI ACTGG 2 cut(s) 129, 334
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 7 cut(s) 21, 31, 50, 67, 74, 290, 324
BssT1I CCWWGG 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 322
Bst4CI ACNGT 2 cut(s) 87, 304
Bst6I CTCTTC 1 cut(s) 235
BstDEI CTNAG 1 cut(s) 223
BstDSI CCRYGG 1 cut(s) 54
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 7 cut(s) 24, 34, 53, 70, 77, 293, 327
BstMAI GTCTC 1 cut(s) 232
BstMBI GATC 7 cut(s) 21, 31, 50, 67, 74, 290, 324
BstNI CCWGG 1 cut(s) 322
BstNSI RCATGY 1 cut(s) 348
BstSCI CCNGG 1 cut(s) 320
BstSFI CTRYAG 1 cut(s) 101
BstX2I RGATCY 5 cut(s) 50, 67, 74, 290, 324
BstYI RGATCY 5 cut(s) 50, 67, 74, 290, 324
Bsu15I ATCGAT 1 cut(s) 30
BsuI GTATCC 1 cut(s) 5
BsuTUI ATCGAT 1 cut(s) 30
BtgI CCRYGG 1 cut(s) 54
BtsCI GGATG 1 cut(s) 10
CciI TCATGA 1 cut(s) 361
ClaI ATCGAT 1 cut(s) 30
Csp6I GTAC 1 cut(s) 209
CviAII CATG 5 cut(s) 55, 203, 329, 345, 362
CviJI RGCY 1 cut(s) 118
CviKI_1 RGCY 1 cut(s) 118
CviQI GTAC 1 cut(s) 209
DdeI CTNAG 1 cut(s) 223
DpnI GATC 7 cut(s) 23, 33, 52, 69, 76, 292, 326
DpnII GATC 7 cut(s) 21, 31, 50, 67, 74, 290, 324
Eam1104I CTCTTC 1 cut(s) 235
EarI CTCTTC 1 cut(s) 235
Eco130I CCWWGG 1 cut(s) 54
EcoRII CCWGG 1 cut(s) 320
EcoT14I CCWWGG 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 54
FaeI CATG 5 cut(s) 58, 206, 332, 348, 365
FaiI YATR 5 cut(s) 56, 204, 330, 346, 363
FatI CATG 5 cut(s) 54, 202, 328, 344, 361
FokI GGATG 1 cut(s) 17
Hin1II CATG 5 cut(s) 58, 206, 332, 348, 365
HindIII AAGCTT 1 cut(s) 116
HinfI GANTC 1 cut(s) 160
Hpy188I TCNGA 2 cut(s) 67, 310
Hpy188III TCNNGA 3 cut(s) 48, 170, 362
Hpy99I CGWCG 3 cut(s) 152, 155, 158
HpyAV CCTTC 2 cut(s) 252, 368
HpyCH4III ACNGT 2 cut(s) 87, 304
HpyCH4V TGCA 1 cut(s) 103
HpyF3I CTNAG 1 cut(s) 223
Hsp92II CATG 5 cut(s) 58, 206, 332, 348, 365
Kzo9I GATC 7 cut(s) 21, 31, 50, 67, 74, 290, 324
LmnI GCTCC 1 cut(s) 269
LpnPI CCDG 6 cut(s) 137, 142, 231, 307, 334, 347
LweI GCATC 1 cut(s) 175
MaeIII GTNAC 1 cut(s) 340
MalI GATC 7 cut(s) 23, 33, 52, 69, 76, 292, 326
MboI GATC 7 cut(s) 21, 31, 50, 67, 74, 290, 324
MboII GAAGA 5 cut(s) 121, 222, 225, 228, 300
MflI RGATCY 5 cut(s) 50, 67, 74, 290, 324
MluCI AATT 1 cut(s) 59
MmeI TCCRAC 1 cut(s) 159
MnlI CCTC 3 cut(s) 289, 304, 307
MslI CAYNNNNRTG 1 cut(s) 366
MspR9I CCNGG 1 cut(s) 322
MvaI CCWGG 1 cut(s) 322
NcoI CCATGG 1 cut(s) 54
NdeII GATC 7 cut(s) 21, 31, 50, 67, 74, 290, 324
NlaIII CATG 5 cut(s) 58, 206, 332, 348, 365
NlaIV GGNNCC 2 cut(s) 76, 326
NspI RCATGY 1 cut(s) 348
PagI TCATGA 1 cut(s) 361
PcsI WCGNNNNNNNCGW 1 cut(s) 153
PfeI GAWTC 1 cut(s) 160
PfoI TCCNGGA 1 cut(s) 320
Psp6I CCWGG 1 cut(s) 320
PspGI CCWGG 1 cut(s) 320
PspN4I GGNNCC 2 cut(s) 76, 326
PstI CTGCAG 1 cut(s) 105
PsuI RGATCY 5 cut(s) 50, 67, 74, 290, 324
RsaI GTAC 1 cut(s) 210
RsaNI GTAC 1 cut(s) 209
RseI CAYNNNNRTG 1 cut(s) 366
Sau3AI GATC 7 cut(s) 21, 31, 50, 67, 74, 290, 324
ScrFI CCNGG 1 cut(s) 322
SetI ASST 3 cut(s) 120, 317, 360
SfaNI GCATC 1 cut(s) 175
SfcI CTRYAG 1 cut(s) 101
SmiMI CAYNNNNRTG 1 cut(s) 366
SmlI CTYRAG 1 cut(s) 46
SmoI CTYRAG 1 cut(s) 46
Sse9I AATT 1 cut(s) 59
StyD4I CCNGG 1 cut(s) 320
StyI CCWWGG 1 cut(s) 54
TaaI ACNGT 2 cut(s) 87, 304
TaqI TCGA 1 cut(s) 30
TasI AATT 1 cut(s) 59
TfiI GAWTC 1 cut(s) 160
TspDTI ATGAA 2 cut(s) 122, 350
XapI RAATTY 1 cut(s) 59
XceI RCATGY 1 cut(s) 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.