FvH4_5g30240

WAT1-related protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Reverse (-)
21161969 .. 21163414
1446 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g30240.t3

Sequence Viewer

Length: 210 bp
ATGAAGAAGATGAGTGTTCTAGTTGTGGTGTTGGTTCTGTGCGTGATGGCCTCTAATTTGGAGCAGAGCTTTGCTCAGGTCGACTGCATCGATGCTTGTACCACCGGCTGTGTTGCATATTTTAACAACCCAAGGCTTATGTCACGCTGTGATCGCAAATGCCAGATAAAATGTGGTCCAGATTCTCAAGTTGAGGAGAATTCGCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.66

Weight (kDa)

6.51

Isoelectric Point (pI)

51.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014186)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 81
AcsI RAATTY 1 cut(s) 199
AdeI CACNNNGTG 1 cut(s) 149
AfaI GTAC 1 cut(s) 100
AluBI AGCT 1 cut(s) 69
AluI AGCT 1 cut(s) 69
AoxI GGCC 1 cut(s) 48
ApoI RAATTY 1 cut(s) 199
AspS9I GGNCC 1 cut(s) 176
AvaII GGWCC 1 cut(s) 176
BccI CCATC 1 cut(s) 40
BfaI CTAG 1 cut(s) 20
Bme18I GGWCC 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 176
BmsI GCATC 2 cut(s) 82, 96
BplI GAGNNNNNCTC 2 cut(s) 58, 90
Bpu10I CCTNAGC 1 cut(s) 75
BpuEI CTTGAG 1 cut(s) 171
Bsa29I ATCGAT 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 131
Bse118I RCCGGY 1 cut(s) 104
BseCI ATCGAT 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 131
BseMII CTCAG 1 cut(s) 89
BseRI GAGGAG 1 cut(s) 209
BshFI GGCC 1 cut(s) 50
BshVI ATCGAT 1 cut(s) 90
BsiSI CCGG 1 cut(s) 105
BsnI GGCC 1 cut(s) 50
Bsp143I GATC 1 cut(s) 151
BspANI GGCC 1 cut(s) 50
BspCNI CTCAG 1 cut(s) 88
BspDI ATCGAT 1 cut(s) 90
BsrFI RCCGGY 1 cut(s) 104
BssAI RCCGGY 1 cut(s) 104
BssECI CCNNGG 1 cut(s) 131
BssMI GATC 1 cut(s) 151
BssT1I CCWWGG 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 75
BstKTI GATC 1 cut(s) 154
BstMBI GATC 1 cut(s) 151
BstMWI GCNNNNNNNGC 1 cut(s) 153
Bsu15I ATCGAT 1 cut(s) 90
BsuRI GGCC 1 cut(s) 50
BsuTUI ATCGAT 1 cut(s) 90
Cfr10I RCCGGY 1 cut(s) 104
Cfr13I GGNCC 1 cut(s) 176
ClaI ATCGAT 1 cut(s) 90
Csp6I GTAC 1 cut(s) 99
CviJI RGCY 4 cut(s) 50, 69, 108, 136
CviKI_1 RGCY 4 cut(s) 50, 69, 108, 136
CviQI GTAC 1 cut(s) 99
DdeI CTNAG 1 cut(s) 75
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
DraIII CACNNNGTG 1 cut(s) 149
Eco130I CCWWGG 1 cut(s) 131
Eco47I GGWCC 1 cut(s) 176
EcoRI GAATTC 1 cut(s) 199
EcoT14I CCWWGG 1 cut(s) 131
ErhI CCWWGG 1 cut(s) 131
FaiI YATR 2 cut(s) 118, 140
FblI GTMKAC 1 cut(s) 81
FspBI CTAG 1 cut(s) 20
HaeIII GGCC 1 cut(s) 50
HapII CCGG 1 cut(s) 105
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HinfI GANTC 1 cut(s) 182
HpaII CCGG 1 cut(s) 105
Hpy166II GTNNAC 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 82
HpyCH4V TGCA 2 cut(s) 87, 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 153
HpyF3I CTNAG 1 cut(s) 75
Kzo9I GATC 1 cut(s) 151
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 4 cut(s) 62, 118, 176, 192
LweI GCATC 2 cut(s) 82, 96
MaeI CTAG 1 cut(s) 20
MaeIII GTNAC 1 cut(s) 141
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 2 cut(s) 16, 19
MluCI AATT 2 cut(s) 55, 199
MnlI CCTC 2 cut(s) 61, 187
MseI TTAA 1 cut(s) 123
MspI CCGG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 153
NdeII GATC 1 cut(s) 151
NmuCI GTSAC 1 cut(s) 141
PcsI WCGNNNNNNNCGW 1 cut(s) 87
PfeI GAWTC 1 cut(s) 182
PspPI GGNCC 1 cut(s) 176
RsaI GTAC 1 cut(s) 100
RsaNI GTAC 1 cut(s) 99
SalI GTCGAC 1 cut(s) 80
SaqAI TTAA 1 cut(s) 123
Sau3AI GATC 1 cut(s) 151
Sau96I GGNCC 1 cut(s) 176
SetI ASST 2 cut(s) 71, 81
SfaNI GCATC 2 cut(s) 82, 96
SinI GGWCC 1 cut(s) 176
SmlI CTYRAG 1 cut(s) 186
SmoI CTYRAG 1 cut(s) 186
Sse9I AATT 2 cut(s) 55, 199
SspMI CTAG 1 cut(s) 20
StyI CCWWGG 1 cut(s) 131
TaqI TCGA 2 cut(s) 81, 90
TasI AATT 2 cut(s) 55, 199
TfiI GAWTC 1 cut(s) 182
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TseFI GTSAC 1 cut(s) 141
Tsp45I GTSAC 1 cut(s) 141
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 176
XapI RAATTY 1 cut(s) 199
XcmI CCANNNNNNNNNTGG 1 cut(s) 170
XmiI GTMKAC 1 cut(s) 81
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.