Rh7DG369700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
50060438 .. 50062164
1727 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG369700.1

Sequence Viewer

Length: 168 bp
ATGAAGAAGATAAGTGCTCTAGTTCTAGTTTTGGTTCTATGCGTGATGACCTCTAATGTGAAGCAGAGCCTTGCTCAGGTTGACTGCTACGATGCTTGTTCCACTGGCTGTGTTGCATATATAAACAACCGTAAGTCCACTCGCAACCAATCTTTCAAACCTCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.05

Weight (kDa)

9.34

Isoelectric Point (pI)

28.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014186)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 76
AgsI TTSAA 1 cut(s) 157
Alw21I GWGCWC 1 cut(s) 19
Bbv12I GWGCWC 1 cut(s) 19
BfaI CTAG 2 cut(s) 20, 26
BmsI GCATC 1 cut(s) 82
BplI GAGNNNNNCTC 2 cut(s) 58, 90
Bpu10I CCTNAGC 1 cut(s) 75
Bsc4I CCNNNNNNNGG 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 109
BseLI CCNNNNNNNGG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 89
BseNI ACTGG 1 cut(s) 109
BsiHKAI GWGCWC 1 cut(s) 19
BslI CCNNNNNNNGG 1 cut(s) 76
Bsp1286I GDGCHC 1 cut(s) 19
BspCNI CTCAG 1 cut(s) 88
BsrI ACTGG 1 cut(s) 109
Bst4CI ACNGT 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 75
BstENI CCTNNNNNAGG 1 cut(s) 74
BtsIMutI CAGTG 1 cut(s) 102
CviJI RGCY 2 cut(s) 69, 108
CviKI_1 RGCY 2 cut(s) 69, 108
DdeI CTNAG 1 cut(s) 75
EcoNI CCTNNNNNAGG 1 cut(s) 74
FaiI YATR 4 cut(s) 40, 118, 120, 122
FspBI CTAG 2 cut(s) 20, 26
FspEI CC 9 cut(s) 17, 62, 64, 83, 90, 115, 143, 151, 161
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
Hpy166II GTNNAC 2 cut(s) 82, 138
Hpy188I TCNGA 1 cut(s) 167
Hpy8I GTNNAC 2 cut(s) 82, 138
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4V TGCA 1 cut(s) 116
HpyF3I CTNAG 1 cut(s) 75
LpnPI CCDG 2 cut(s) 62, 90
LweI GCATC 1 cut(s) 82
MaeI CTAG 2 cut(s) 20, 26
MboII GAAGA 2 cut(s) 16, 19
MhlI GDGCHC 1 cut(s) 19
MnlI CCTC 1 cut(s) 61
SduI GDGCHC 1 cut(s) 19
SetI ASST 3 cut(s) 53, 81, 163
SfaNI GCATC 1 cut(s) 82
SgeI CNNG 8 cut(s) 32, 38, 55, 83, 89, 108, 117, 153
SspMI CTAG 2 cut(s) 20, 26
TaaI ACNGT 1 cut(s) 131
TscAI CASTG 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 109
XagI CCTNNNNNAGG 1 cut(s) 74
XspI CTAG 2 cut(s) 20, 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.