Rh7CG398500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
50844468 .. 50846090
1623 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG398500.1

Sequence Viewer

Length: 210 bp
ATGAAGAAGATAAGTGTTCTAGTTCTAGTGTTGGTTCTATGCGTGATGACCTCTAATGTGAAGCAGAGCCTTGCTCAGGTTGACTGCTACGATGCTTGTTCCACTGGCTGTGTTTCATATATAAACAACCCGAGGCTTATGTCACGATGTGATCGCAAATGCCAGATTAAATGTGGTCCAGATTCTCAAGTTGAGGAGAATTTTCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.71

Weight (kDa)

8.2

Isoelectric Point (pI)

33.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014186)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 199
AdeI CACNNNGTG 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 76
Ama87I CYCGRG 1 cut(s) 130
ApoI RAATTY 1 cut(s) 199
AspS9I GGNCC 1 cut(s) 176
AvaI CYCGRG 1 cut(s) 130
AvaII GGWCC 1 cut(s) 176
BfaI CTAG 2 cut(s) 20, 26
Bme18I GGWCC 1 cut(s) 176
BmeT110I CYCGRG 1 cut(s) 130
BmgT120I GGNCC 1 cut(s) 176
BmsI GCATC 1 cut(s) 82
BplI GAGNNNNNCTC 2 cut(s) 58, 90
Bpu10I CCTNAGC 1 cut(s) 75
BpuEI CTTGAG 1 cut(s) 171
BsaJI CCNNGG 1 cut(s) 131
Bsc4I CCNNNNNNNGG 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 109
BseDI CCNNGG 1 cut(s) 131
BseLI CCNNNNNNNGG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 89
BseNI ACTGG 1 cut(s) 109
BseRI GAGGAG 1 cut(s) 209
BsiHKCI CYCGRG 1 cut(s) 130
BslI CCNNNNNNNGG 1 cut(s) 76
BsoBI CYCGRG 1 cut(s) 130
Bsp143I GATC 1 cut(s) 151
BspCNI CTCAG 1 cut(s) 88
BsrI ACTGG 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 131
BssMI GATC 1 cut(s) 151
BstDEI CTNAG 1 cut(s) 75
BstENI CCTNNNNNAGG 1 cut(s) 74
BstKTI GATC 1 cut(s) 154
BstMBI GATC 1 cut(s) 151
BtsIMutI CAGTG 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 176
CviJI RGCY 3 cut(s) 69, 108, 136
CviKI_1 RGCY 3 cut(s) 69, 108, 136
DdeI CTNAG 1 cut(s) 75
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
DraIII CACNNNGTG 1 cut(s) 149
Eco47I GGWCC 1 cut(s) 176
Eco88I CYCGRG 1 cut(s) 130
EcoNI CCTNNNNNAGG 1 cut(s) 74
FaiI YATR 5 cut(s) 40, 118, 120, 122, 140
FspBI CTAG 2 cut(s) 20, 26
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HinfI GANTC 1 cut(s) 182
Hpy166II GTNNAC 1 cut(s) 82
Hpy188III TCNNGA 2 cut(s) 144, 179
Hpy8I GTNNAC 1 cut(s) 82
HpyF3I CTNAG 1 cut(s) 75
Kzo9I GATC 1 cut(s) 151
LpnPI CCDG 4 cut(s) 62, 90, 176, 192
LweI GCATC 1 cut(s) 82
MaeI CTAG 2 cut(s) 20, 26
MaeIII GTNAC 1 cut(s) 141
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 2 cut(s) 16, 19
MluCI AATT 1 cut(s) 199
MnlI CCTC 3 cut(s) 61, 126, 187
MseI TTAA 1 cut(s) 168
NdeII GATC 1 cut(s) 151
NmuCI GTSAC 1 cut(s) 141
PfeI GAWTC 1 cut(s) 182
PspPI GGNCC 1 cut(s) 176
SaqAI TTAA 1 cut(s) 168
Sau3AI GATC 1 cut(s) 151
Sau96I GGNCC 1 cut(s) 176
SetI ASST 2 cut(s) 53, 81
SfaNI GCATC 1 cut(s) 82
SinI GGWCC 1 cut(s) 176
SmlI CTYRAG 1 cut(s) 186
SmoI CTYRAG 1 cut(s) 186
Sse9I AATT 1 cut(s) 199
SspMI CTAG 2 cut(s) 20, 26
TasI AATT 1 cut(s) 199
TfiI GAWTC 1 cut(s) 182
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TscAI CASTG 1 cut(s) 109
TseFI GTSAC 1 cut(s) 141
Tsp45I GTSAC 1 cut(s) 141
TspDTI ATGAA 3 cut(s) 17, 105, 194
TspRI CASTG 1 cut(s) 109
VpaK11BI GGWCC 1 cut(s) 176
XagI CCTNNNNNAGG 1 cut(s) 74
XapI RAATTY 1 cut(s) 199
XcmI CCANNNNNNNNNTGG 1 cut(s) 170
XspI CTAG 2 cut(s) 20, 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.