Prupe.1G561600_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
45848750 .. 45849794
1045 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G561600.1

Sequence Viewer

Length: 219 bp
ATGTCGACGGTGAAGAAGATGGCAGTTGCTCTGTTGGTTCTGTGTGCGGTGTTTTCTTGTATGGAGAAGGTGGTAGATTCTGCTGATGCTGGAGTTGACTGCTATGATGCTTGCAACACTGGCTGTGTTCAAAGCAACACGAGACTTTATCAACGCTGTGATCGCAAGTGCCAGATTAAGTGCGGTCCAGATTCTGAAGTTGAGGGAAACCTACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

7.81

Weight (kDa)

5.13

Isoelectric Point (pI)

44.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014186)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 5
AciI CCGC 2 cut(s) 47, 183
AcuI CTGAAG 1 cut(s) 216
AgsI TTSAA 1 cut(s) 131
Alw26I GTCTC 1 cut(s) 136
AlwNI CAGNNNCTG 1 cut(s) 194
AspS9I GGNCC 1 cut(s) 185
AsuHPI GGTGA 1 cut(s) 22
AvaII GGWCC 1 cut(s) 185
BauI CACGAG 1 cut(s) 139
BccI CCATC 1 cut(s) 13
BcoDI GTCTC 1 cut(s) 136
BfmI CTRYAG 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 185
BmsI GCATC 2 cut(s) 76, 97
BpmI CTGGAG 1 cut(s) 111
Bse1I ACTGG 1 cut(s) 124
BseNI ACTGG 1 cut(s) 124
BsmAI GTCTC 1 cut(s) 136
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 2 cut(s) 47, 183
BsrI ACTGG 1 cut(s) 124
BssMI GATC 1 cut(s) 160
BssSI CACGAG 1 cut(s) 139
Bst2BI CACGAG 1 cut(s) 139
Bst4CI ACNGT 2 cut(s) 10, 216
BstC8I GCNNGC 1 cut(s) 112
BstKTI GATC 1 cut(s) 163
BstMAI GTCTC 1 cut(s) 136
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 2 cut(s) 120, 162
BstSFI CTRYAG 1 cut(s) 212
BtsIMutI CAGTG 1 cut(s) 117
Cac8I GCNNGC 1 cut(s) 112
CaiI CAGNNNCTG 1 cut(s) 194
Cfr13I GGNCC 1 cut(s) 185
CviJI RGCY 1 cut(s) 123
CviKI_1 RGCY 1 cut(s) 123
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
Eco47I GGWCC 1 cut(s) 185
Eco57I CTGAAG 1 cut(s) 216
FaiI YATR 2 cut(s) 62, 105
FblI GTMKAC 1 cut(s) 5
GsuI CTGGAG 1 cut(s) 111
HincII GTYRAC 2 cut(s) 6, 97
HindII GTYRAC 2 cut(s) 6, 97
HinfI GANTC 2 cut(s) 77, 191
HphI GGTGA 1 cut(s) 22
Hpy166II GTNNAC 2 cut(s) 6, 97
Hpy188I TCNGA 1 cut(s) 196
Hpy188III TCNNGA 1 cut(s) 188
Hpy8I GTNNAC 2 cut(s) 6, 97
Hpy99I CGWCG 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 61
HpyCH4III ACNGT 2 cut(s) 10, 216
HpyCH4V TGCA 1 cut(s) 114
HpyF10VI GCNNNNNNNGC 2 cut(s) 120, 162
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 4 cut(s) 75, 105, 185, 201
LweI GCATC 2 cut(s) 76, 97
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 2 cut(s) 25, 28
MnlI CCTC 1 cut(s) 196
MseI TTAA 1 cut(s) 177
MwoI GCNNNNNNNGC 2 cut(s) 120, 162
NdeII GATC 1 cut(s) 160
PfeI GAWTC 2 cut(s) 77, 191
PspPI GGNCC 1 cut(s) 185
PstNI CAGNNNCTG 1 cut(s) 194
SalI GTCGAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 177
Sau3AI GATC 1 cut(s) 160
Sau96I GGNCC 1 cut(s) 185
SetI ASST 2 cut(s) 72, 213
SfaNI GCATC 2 cut(s) 76, 97
SfcI CTRYAG 1 cut(s) 212
SgeI CNNG 9 cut(s) 69, 102, 123, 132, 151, 153, 178, 184, 200
SinI GGWCC 1 cut(s) 185
SsiI CCGC 2 cut(s) 47, 183
TaaI ACNGT 2 cut(s) 10, 216
TaqI TCGA 1 cut(s) 5
TfiI GAWTC 2 cut(s) 77, 191
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TscAI CASTG 1 cut(s) 124
TspRI CASTG 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 185
XmiI GTMKAC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.