Prupe.4G249100_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Reverse (-)
16652540 .. 16652996
457 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G249100.1

Sequence Viewer

Length: 210 bp
ATGGAAGGGACGTCCTCCCGGATCGTCAAACCCAGCTCCTTCTGTAAAGCTGGCCTGGAAGATCAACATACTGCTGATGCTGGAGTTGACTGCTATGATGCTTGCAACACTGGCTGTGTTCAAAGCAACACGAGACTTTATCAACGCTGTGATCGCAAGTGCAAGATTAGGTGCGGTCCAGATTCTGAAGTTGAGGGGAACCTACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.55

Weight (kDa)

5.67

Isoelectric Point (pI)

35.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014186)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 14
AciI CCGC 1 cut(s) 174
AclWI GGATC 1 cut(s) 29
AcuI CTGAAG 1 cut(s) 207
AcyI GRCGYC 1 cut(s) 11
AgsI TTSAA 1 cut(s) 122
AjnI CCWGG 1 cut(s) 54
AluBI AGCT 2 cut(s) 36, 50
AluI AGCT 2 cut(s) 36, 50
Alw26I GTCTC 1 cut(s) 127
AlwI GGATC 1 cut(s) 29
AlwNI CAGNNNCTG 1 cut(s) 185
AoxI GGCC 1 cut(s) 52
AspS9I GGNCC 1 cut(s) 176
AsuC2I CCSGG 1 cut(s) 19
AvaII GGWCC 1 cut(s) 176
BauI CACGAG 1 cut(s) 130
BciT130I CCWGG 1 cut(s) 56
BcnI CCSGG 1 cut(s) 19
BcoDI GTCTC 1 cut(s) 127
BfmI CTRYAG 1 cut(s) 203
Bme1390I CCNGG 2 cut(s) 19, 56
Bme18I GGWCC 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 1 cut(s) 200
BmrFI CCNGG 2 cut(s) 19, 56
BmsI GCATC 2 cut(s) 67, 88
BpmI CTGGAG 1 cut(s) 102
BpuMI CCSGG 1 cut(s) 19
BsaHI GRCGYC 1 cut(s) 11
Bse1I ACTGG 1 cut(s) 115
BseBI CCWGG 1 cut(s) 56
BseNI ACTGG 1 cut(s) 115
BseYI CCCAGC 1 cut(s) 32
BshFI GGCC 1 cut(s) 54
BsiSI CCGG 1 cut(s) 19
BslFI GGGAC 1 cut(s) 22
BsmAI GTCTC 1 cut(s) 127
BsmFI GGGAC 1 cut(s) 22
BsnI GGCC 1 cut(s) 54
Bsp143I GATC 3 cut(s) 21, 61, 151
BspACI CCGC 1 cut(s) 174
BspANI GGCC 1 cut(s) 54
BspLI GGNNCC 1 cut(s) 200
BspPI GGATC 1 cut(s) 29
BsrI ACTGG 1 cut(s) 115
BssMI GATC 3 cut(s) 21, 61, 151
BssNI GRCGYC 1 cut(s) 11
BssSI CACGAG 1 cut(s) 130
Bst2BI CACGAG 1 cut(s) 130
Bst2UI CCWGG 1 cut(s) 56
Bst4CI ACNGT 1 cut(s) 207
BstACI GRCGYC 1 cut(s) 11
BstC8I GCNNGC 2 cut(s) 52, 103
BstKTI GATC 3 cut(s) 24, 64, 154
BstMAI GTCTC 1 cut(s) 127
BstMBI GATC 3 cut(s) 21, 61, 151
BstMWI GCNNNNNNNGC 2 cut(s) 111, 153
BstNI CCWGG 1 cut(s) 56
BstSCI CCNGG 2 cut(s) 17, 54
BstSFI CTRYAG 1 cut(s) 203
BsuRI GGCC 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 108
Cac8I GCNNGC 2 cut(s) 52, 103
CaiI CAGNNNCTG 1 cut(s) 185
Cfr13I GGNCC 1 cut(s) 176
CviJI RGCY 4 cut(s) 36, 50, 54, 114
CviKI_1 RGCY 4 cut(s) 36, 50, 54, 114
DpnI GATC 3 cut(s) 23, 63, 153
DpnII GATC 3 cut(s) 21, 61, 151
Eco47I GGWCC 1 cut(s) 176
Eco57I CTGAAG 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 54
FaiI YATR 2 cut(s) 69, 96
FaqI GGGAC 1 cut(s) 22
GsaI CCCAGC 1 cut(s) 36
GsuI CTGGAG 1 cut(s) 102
HaeIII GGCC 1 cut(s) 54
HapII CCGG 1 cut(s) 19
Hin1I GRCGYC 1 cut(s) 11
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HinfI GANTC 1 cut(s) 182
HpaII CCGG 1 cut(s) 19
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 187
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 88
HpyAV CCTTC 1 cut(s) 49
HpyCH4III ACNGT 1 cut(s) 207
HpyCH4IV ACGT 1 cut(s) 11
HpyCH4V TGCA 2 cut(s) 105, 162
HpyF10VI GCNNNNNNNGC 2 cut(s) 111, 153
HpySE526I ACGT 1 cut(s) 11
Hsp92I GRCGYC 1 cut(s) 11
Kzo9I GATC 3 cut(s) 21, 61, 151
LmnI GCTCC 1 cut(s) 41
LpnPI CCDG 8 cut(s) 32, 36, 41, 46, 66, 68, 96, 192
LweI GCATC 2 cut(s) 67, 88
MaeII ACGT 1 cut(s) 11
MalI GATC 3 cut(s) 23, 63, 153
MboI GATC 3 cut(s) 21, 61, 151
MboII GAAGA 1 cut(s) 71
MnlI CCTC 2 cut(s) 25, 187
MspI CCGG 1 cut(s) 19
MspR9I CCNGG 2 cut(s) 19, 56
MvaI CCWGG 1 cut(s) 56
MwoI GCNNNNNNNGC 2 cut(s) 111, 153
NciI CCSGG 1 cut(s) 19
NdeII GATC 3 cut(s) 21, 61, 151
NlaIV GGNNCC 1 cut(s) 200
PfeI GAWTC 1 cut(s) 182
PfoI TCCNGGA 1 cut(s) 17
Psp6I CCWGG 1 cut(s) 54
PspFI CCCAGC 1 cut(s) 32
PspGI CCWGG 1 cut(s) 54
PspN4I GGNNCC 1 cut(s) 200
PspPI GGNCC 1 cut(s) 176
PstNI CAGNNNCTG 1 cut(s) 185
Sau3AI GATC 3 cut(s) 21, 61, 151
Sau96I GGNCC 1 cut(s) 176
ScrFI CCNGG 2 cut(s) 19, 56
SetI ASST 5 cut(s) 14, 38, 52, 173, 204
SfaNI GCATC 2 cut(s) 67, 88
SfcI CTRYAG 1 cut(s) 203
SinI GGWCC 1 cut(s) 176
SsiI CCGC 1 cut(s) 174
StyD4I CCNGG 2 cut(s) 17, 54
TaaI ACNGT 1 cut(s) 207
TaiI ACGT 1 cut(s) 14
TfiI GAWTC 1 cut(s) 182
TscAI CASTG 1 cut(s) 115
TspRI CASTG 1 cut(s) 115
VpaK11BI GGWCC 1 cut(s) 176
ZraI GACGTC 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.