FvH4_5g32051

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
23136945 .. 23139182
2238 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g32051.t1

Sequence Viewer

Length: 480 bp
ATGATCACTTTGCTATTCAATTGTTTGGAAGAAGAAATAAAATCCGTCCCATACGAGGAGGCATTAGATTTCATTCGTGATGATGATACTGGTGACAACGTTGAGGATGATTCTAATGACGATGATACTAATGACAGCGCTGACTATGATACTGAAGACAGTTTTGATGAGGGAGCAGCAAGCTACGTCCCATCTGATGCTGATAATGGAACTGTTGGTGATTATGGTGAAGATGATGATGGAGGAGCAAGACGTGATCAAGTTGTTGATGAGGATGCACCTACCAACAGACTGAGGAGGTCTGATCCTAGTTTGTTCCAACTGCAATCCTCTTTCTTTGAGGAGATCCAACAACTGCAATCTGTGAATTGGGAGTTGAGAAGACAGTTGATGCTATCACAGCAGCCAAATCCGATTGGTGTTAAAAGAAATTTTTGGGAACGGTGTATGACTAATGACTTTGTTCCGCGAGATGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

160

Amino Acids

18.16

Weight (kDa)

4.05

Isoelectric Point (pI)

62.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019714)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 469
AciI CCGC 1 cut(s) 467
AclI AACGTT 1 cut(s) 99
AclWI GGATC 2 cut(s) 299, 340
AcsI RAATTY 1 cut(s) 430
AcuI CTGAAG 1 cut(s) 174
AfeI AGCGCT 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 19
AjiI CACGTC 1 cut(s) 254
AluBI AGCT 1 cut(s) 183
AluI AGCT 1 cut(s) 183
AlwI GGATC 2 cut(s) 299, 340
Aor51HI AGCGCT 1 cut(s) 139
ApeKI GCWGC 2 cut(s) 176, 403
ApoI RAATTY 1 cut(s) 430
AspLEI GCGC 1 cut(s) 140
AsuHPI GGTGA 3 cut(s) 104, 230, 239
BbsI GAAGAC 2 cut(s) 162, 388
BbvI GCAGC 2 cut(s) 188, 415
BccI CCATC 2 cut(s) 199, 233
BclI TGATCA 2 cut(s) 3, 256
BfaI CTAG 1 cut(s) 309
BfoI RGCGCY 1 cut(s) 141
BisI GCNGC 2 cut(s) 177, 404
BlsI GCNGC 2 cut(s) 178, 405
BmgBI CACGTC 1 cut(s) 254
BmsI GCATC 4 cut(s) 187, 265, 381, 463
BpiI GAAGAC 2 cut(s) 162, 388
Bsc4I CCNNNNNNNGG 1 cut(s) 55
Bse1I ACTGG 1 cut(s) 94
BseGI GGATG 2 cut(s) 112, 280
BseLI CCNNNNNNNGG 1 cut(s) 55
BseMII CTCAG 1 cut(s) 284
BseNI ACTGG 1 cut(s) 94
BseRI GAGGAG 4 cut(s) 71, 258, 310, 356
BseXI GCAGC 2 cut(s) 188, 415
Bsh1236I CGCG 1 cut(s) 469
BslFI GGGAC 2 cut(s) 32, 173
BslI CCNNNNNNNGG 1 cut(s) 55
BsmFI GGGAC 2 cut(s) 32, 173
Bsp143I GATC 4 cut(s) 3, 256, 304, 345
BspACI CCGC 1 cut(s) 467
BspCNI CTCAG 1 cut(s) 285
BspFNI CGCG 1 cut(s) 469
BspPI GGATC 2 cut(s) 299, 340
BsrI ACTGG 1 cut(s) 94
BssMI GATC 4 cut(s) 3, 256, 304, 345
Bst4CI ACNGT 4 cut(s) 161, 214, 387, 444
BstC8I GCNNGC 1 cut(s) 181
BstDEI CTNAG 1 cut(s) 293
BstF5I GGATG 2 cut(s) 112, 280
BstFNI CGCG 1 cut(s) 469
BstH2I RGCGCY 1 cut(s) 141
BstHHI GCGC 1 cut(s) 140
BstKTI GATC 4 cut(s) 6, 259, 307, 348
BstMBI GATC 4 cut(s) 3, 256, 304, 345
BstMWI GCNNNNNNNGC 1 cut(s) 400
BstUI CGCG 1 cut(s) 469
BstV1I GCAGC 2 cut(s) 188, 415
BstV2I GAAGAC 2 cut(s) 162, 388
BstX2I RGATCY 1 cut(s) 345
BstYI RGATCY 1 cut(s) 345
BtrI CACGTC 1 cut(s) 254
BtsCI GGATG 2 cut(s) 112, 280
Cac8I GCNNGC 1 cut(s) 181
CfoI GCGC 1 cut(s) 140
CviJI RGCY 2 cut(s) 183, 406
CviKI_1 RGCY 2 cut(s) 183, 406
DdeI CTNAG 1 cut(s) 293
DpnI GATC 4 cut(s) 5, 258, 306, 347
DpnII GATC 4 cut(s) 3, 256, 304, 345
Eco47III AGCGCT 1 cut(s) 139
Eco57I CTGAAG 1 cut(s) 174
FaiI YATR 4 cut(s) 52, 147, 225, 449
FaqI GGGAC 2 cut(s) 32, 173
FbaI TGATCA 2 cut(s) 3, 256
Fnu4HI GCNGC 2 cut(s) 177, 404
FokI GGATG 2 cut(s) 119, 287
Fsp4HI GCNGC 2 cut(s) 177, 404
FspBI CTAG 1 cut(s) 309
GlaI GCGC 1 cut(s) 139
GluI GCNGC 2 cut(s) 177, 404
HaeII RGCGCY 1 cut(s) 141
HhaI GCGC 1 cut(s) 140
Hin6I GCGC 1 cut(s) 138
HinP1I GCGC 1 cut(s) 138
HinfI GANTC 1 cut(s) 110
HphI GGTGA 3 cut(s) 104, 230, 239
Hpy188I TCNGA 3 cut(s) 196, 304, 414
Hpy188III TCNNGA 1 cut(s) 77
HpyCH4III ACNGT 4 cut(s) 161, 214, 387, 444
HpyCH4IV ACGT 3 cut(s) 99, 186, 253
HpyCH4V TGCA 3 cut(s) 278, 325, 358
HpyF10VI GCNNNNNNNGC 1 cut(s) 400
HpyF3I CTNAG 1 cut(s) 293
HpySE526I ACGT 3 cut(s) 99, 186, 253
HspAI GCGC 1 cut(s) 138
Ksp22I TGATCA 2 cut(s) 3, 256
Kzo9I GATC 4 cut(s) 3, 256, 304, 345
LmnI GCTCC 2 cut(s) 173, 245
LpnPI CCDG 1 cut(s) 75
Lsp1109I GCAGC 2 cut(s) 188, 415
LweI GCATC 4 cut(s) 187, 265, 381, 463
MaeI CTAG 1 cut(s) 309
MaeII ACGT 3 cut(s) 99, 186, 253
MaeIII GTNAC 1 cut(s) 92
MalI GATC 4 cut(s) 5, 258, 306, 347
MboI GATC 4 cut(s) 3, 256, 304, 345
MboII GAAGA 5 cut(s) 41, 44, 167, 242, 393
MfeI CAATTG 1 cut(s) 19
MflI RGATCY 1 cut(s) 345
MluCI AATT 3 cut(s) 19, 367, 430
MmeI TCCRAC 2 cut(s) 343, 373
MseI TTAA 1 cut(s) 423
MunI CAATTG 1 cut(s) 19
MvnI CGCG 1 cut(s) 469
MwoI GCNNNNNNNGC 1 cut(s) 400
NdeII GATC 4 cut(s) 3, 256, 304, 345
NmuCI GTSAC 1 cut(s) 92
PfeI GAWTC 1 cut(s) 110
PkrI GCNGC 2 cut(s) 178, 405
Psp1406I AACGTT 1 cut(s) 99
PsuI RGATCY 1 cut(s) 345
SaqAI TTAA 1 cut(s) 423
SatI GCNGC 2 cut(s) 177, 404
Sau3AI GATC 4 cut(s) 3, 256, 304, 345
SetI ASST 6 cut(s) 102, 185, 189, 256, 283, 302
SfaNI GCATC 4 cut(s) 187, 265, 381, 463
SgeI CNNG 8 cut(s) 67, 89, 102, 192, 261, 266, 272, 321
Sse9I AATT 3 cut(s) 19, 367, 430
SsiI CCGC 1 cut(s) 467
SspMI CTAG 1 cut(s) 309
TaaI ACNGT 4 cut(s) 161, 214, 387, 444
TaiI ACGT 3 cut(s) 102, 189, 256
TasI AATT 3 cut(s) 19, 367, 430
TfiI GAWTC 1 cut(s) 110
Tru1I TTAA 1 cut(s) 423
Tru9I TTAA 1 cut(s) 423
TseFI GTSAC 1 cut(s) 92
TseI GCWGC 2 cut(s) 176, 403
Tsp45I GTSAC 1 cut(s) 92
TspDTI ATGAA 1 cut(s) 61
TspGWI ACGGA 1 cut(s) 34
XapI RAATTY 1 cut(s) 430
XspI CTAG 1 cut(s) 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.