Rroxscaffold_3G00231500

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
16771624 .. 16778525
6902 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00231500.1

Sequence Viewer

Length: 168 bp
ATGGTTTCATTTCCACAGGGTGAGAGAGAAACAGTGAAAGGAAGAACTTGGGGACGCTCTGATCGAAATTCCAGGTTGTGCGACAGAGGTATTTATTTGATTCTTGAGGATCAGAAGCCAGATTACTTGGATCAAGAAACTTCCACCAGCCAAGAAGGTGACCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.42

Weight (kDa)

4.92

Isoelectric Point (pI)

33.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019714)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 117, 138
AcsI RAATTY 1 cut(s) 67
AdeI CACNNNGTG 1 cut(s) 20
AjnI CCWGG 1 cut(s) 71
AlwI GGATC 2 cut(s) 117, 138
ApoI RAATTY 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 32
BarI GAAGNNNNNNTAC 2 cut(s) 107, 139
BciT130I CCWGG 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 73
BmrFI CCNGG 1 cut(s) 73
BpuEI CTTGAG 1 cut(s) 125
BseBI CCWGG 1 cut(s) 73
BslFI GGGAC 1 cut(s) 66
BsmFI GGGAC 1 cut(s) 66
Bsp143I GATC 3 cut(s) 61, 109, 130
BspPI GGATC 2 cut(s) 117, 138
BssMI GATC 3 cut(s) 61, 109, 130
Bst2UI CCWGG 1 cut(s) 73
Bst4CI ACNGT 1 cut(s) 34
BstEII GGTNACC 1 cut(s) 158
BstKTI GATC 3 cut(s) 64, 112, 133
BstMBI GATC 3 cut(s) 61, 109, 130
BstNI CCWGG 1 cut(s) 73
BstPI GGTNACC 1 cut(s) 158
BstSCI CCNGG 1 cut(s) 71
BtsIMutI CAGTG 1 cut(s) 39
CseI GACGC 1 cut(s) 63
CviJI RGCY 2 cut(s) 118, 150
CviKI_1 RGCY 2 cut(s) 118, 150
DpnI GATC 3 cut(s) 63, 111, 132
DpnII GATC 3 cut(s) 61, 109, 130
DraIII CACNNNGTG 1 cut(s) 20
Eco91I GGTNACC 1 cut(s) 158
EcoO65I GGTNACC 1 cut(s) 158
EcoRII CCWGG 1 cut(s) 71
FaqI GGGAC 1 cut(s) 66
HgaI GACGC 1 cut(s) 63
HinfI GANTC 1 cut(s) 100
HphI GGTGA 1 cut(s) 32
Hpy188I TCNGA 2 cut(s) 61, 114
Hpy188III TCNNGA 2 cut(s) 104, 134
HpyAV CCTTC 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 34
Kzo9I GATC 3 cut(s) 61, 109, 130
LpnPI CCDG 5 cut(s) 2, 58, 85, 132, 160
MaeIII GTNAC 1 cut(s) 158
MalI GATC 3 cut(s) 63, 111, 132
MboI GATC 3 cut(s) 61, 109, 130
MboII GAAGA 1 cut(s) 54
MluCI AATT 1 cut(s) 67
MnlI CCTC 2 cut(s) 80, 100
MspR9I CCNGG 1 cut(s) 73
MvaI CCWGG 1 cut(s) 73
NdeII GATC 3 cut(s) 61, 109, 130
NmuCI GTSAC 1 cut(s) 158
PcsI WCGNNNNNNNCGW 1 cut(s) 61
PfeI GAWTC 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 71
PspEI GGTNACC 1 cut(s) 158
PspGI CCWGG 1 cut(s) 71
Sau3AI GATC 3 cut(s) 61, 109, 130
ScrFI CCNGG 1 cut(s) 73
SetI ASST 3 cut(s) 77, 91, 160
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
Sse9I AATT 1 cut(s) 67
StyD4I CCNGG 1 cut(s) 71
TaaI ACNGT 1 cut(s) 34
TaqI TCGA 1 cut(s) 64
TasI AATT 1 cut(s) 67
TfiI GAWTC 1 cut(s) 100
TscAI CASTG 1 cut(s) 39
TseFI GTSAC 1 cut(s) 158
Tsp45I GTSAC 1 cut(s) 158
TspRI CASTG 1 cut(s) 39
XapI RAATTY 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.