Rh7DG395800
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
54281855 .. 54282677
823 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG395800.1

Sequence Viewer

Length: 336 bp
ATGGTTTCATTTCCACAAGGTGATGGAGAAACAGAGAGAGGAAGAACTTGGGGACGCTCTGATCGAAATTCCAGGTTGTGCGACAGAGGTAAGCTCTGGAGCTTTCAAGAGAAATGTGATTGCTTGAGGATCGGAAGCCAGATTACTTGGATCAAGAAACTTCCACCAGCCAAGAAGGGAATTGAAAATGTCAGTAACATAAAGGATGGTTATAATCCTGCAACTTGGATGTTGGAGGTCACCAGTTTGGCGAAAGAAATAGCTTATGGTGTTGATTTTGCTGGTGTTTATAAAAAATCAGAGCTATACAGGAGAAACAAAACACATGCTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

111

Amino Acids

12.72

Weight (kDa)

9.37

Isoelectric Point (pI)

42.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019714)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 213, 291
AclWI GGATC 2 cut(s) 137, 158
AcsI RAATTY 1 cut(s) 67
AdeI CACNNNGTG 1 cut(s) 20
AgsI TTSAA 2 cut(s) 107, 185
AjnI CCWGG 1 cut(s) 71
AluBI AGCT 4 cut(s) 94, 102, 263, 304
AluI AGCT 4 cut(s) 94, 102, 263, 304
AlwI GGATC 2 cut(s) 137, 158
ApoI RAATTY 1 cut(s) 67
AsuHPI GGTGA 2 cut(s) 32, 232
BarI GAAGNNNNNNTAC 2 cut(s) 127, 159
BccI CCATC 2 cut(s) 17, 200
BciT130I CCWGG 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 73
BmrFI CCNGG 1 cut(s) 73
BplI GAGNNNNNCTC 2 cut(s) 78, 110
BpmI CTGGAG 1 cut(s) 118
BpuEI CTTGAG 1 cut(s) 145
Bse1I ACTGG 1 cut(s) 243
BseBI CCWGG 1 cut(s) 73
BseGI GGATG 2 cut(s) 211, 234
BseNI ACTGG 1 cut(s) 243
BslFI GGGAC 1 cut(s) 66
BsmFI GGGAC 1 cut(s) 66
Bsp143I GATC 3 cut(s) 61, 129, 150
BspPI GGATC 2 cut(s) 137, 158
BsrI ACTGG 1 cut(s) 243
BssMI GATC 3 cut(s) 61, 129, 150
Bst2UI CCWGG 1 cut(s) 73
BstEII GGTNACC 1 cut(s) 238
BstF5I GGATG 2 cut(s) 211, 234
BstKTI GATC 3 cut(s) 64, 132, 153
BstMBI GATC 3 cut(s) 61, 129, 150
BstNI CCWGG 1 cut(s) 73
BstNSI RCATGY 1 cut(s) 329
BstPI GGTNACC 1 cut(s) 238
BstSCI CCNGG 1 cut(s) 71
BtsCI GGATG 2 cut(s) 211, 234
CseI GACGC 1 cut(s) 63
CviAII CATG 1 cut(s) 326
CviJI RGCY 6 cut(s) 94, 102, 138, 170, 263, 304
CviKI_1 RGCY 6 cut(s) 94, 102, 138, 170, 263, 304
DpnI GATC 3 cut(s) 63, 131, 152
DpnII GATC 3 cut(s) 61, 129, 150
DraIII CACNNNGTG 1 cut(s) 20
Eco91I GGTNACC 1 cut(s) 238
EcoO65I GGTNACC 1 cut(s) 238
EcoRII CCWGG 1 cut(s) 71
FaeI CATG 1 cut(s) 329
FaiI YATR 6 cut(s) 200, 213, 267, 291, 307, 327
FaqI GGGAC 1 cut(s) 66
FatI CATG 1 cut(s) 325
FokI GGATG 2 cut(s) 218, 241
GsuI CTGGAG 1 cut(s) 118
HgaI GACGC 1 cut(s) 63
Hin1II CATG 1 cut(s) 329
HphI GGTGA 2 cut(s) 32, 232
Hpy188I TCNGA 3 cut(s) 61, 134, 301
Hpy188III TCNNGA 3 cut(s) 97, 107, 154
HpyAV CCTTC 1 cut(s) 169
HpyCH4V TGCA 1 cut(s) 221
Hsp92II CATG 1 cut(s) 329
Kzo9I GATC 3 cut(s) 61, 129, 150
LmnI GCTCC 1 cut(s) 99
LpnPI CCDG 9 cut(s) 58, 82, 85, 152, 180, 231, 256, 267, 295
MaeIII GTNAC 2 cut(s) 194, 238
MalI GATC 3 cut(s) 63, 131, 152
MboI GATC 3 cut(s) 61, 129, 150
MboII GAAGA 1 cut(s) 54
MluCI AATT 2 cut(s) 67, 180
MmeI TCCRAC 1 cut(s) 213
MnlI CCTC 4 cut(s) 32, 80, 120, 229
MspR9I CCNGG 1 cut(s) 73
MvaI CCWGG 1 cut(s) 73
NdeII GATC 3 cut(s) 61, 129, 150
NlaIII CATG 1 cut(s) 329
NmuCI GTSAC 1 cut(s) 238
NspI RCATGY 1 cut(s) 329
PcsI WCGNNNNNNNCGW 1 cut(s) 61
PsiI TTATAA 2 cut(s) 213, 291
Psp6I CCWGG 1 cut(s) 71
PspEI GGTNACC 1 cut(s) 238
PspGI CCWGG 1 cut(s) 71
Sau3AI GATC 3 cut(s) 61, 129, 150
ScrFI CCNGG 1 cut(s) 73
SetI ASST 8 cut(s) 22, 77, 91, 96, 104, 240, 265, 306
SmlI CTYRAG 1 cut(s) 124
SmoI CTYRAG 1 cut(s) 124
Sse9I AATT 2 cut(s) 67, 180
StyD4I CCNGG 1 cut(s) 71
TaqI TCGA 1 cut(s) 64
TasI AATT 2 cut(s) 67, 180
TseFI GTSAC 1 cut(s) 238
Tsp45I GTSAC 1 cut(s) 238
XapI RAATTY 1 cut(s) 67
XceI RCATGY 1 cut(s) 329
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.