FvH4_6g02711

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
1547444 .. 1550112
2669 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g02711.t1

Sequence Viewer

Length: 339 bp
ATGTCTCTTAACGTCATAGCTTATGTAGTTACAATAGTTGCCTTCTCCAATTCTTTAGCTCCAACTAACATAACATTGTCTTCATGGGTCCTTAAGACGTATCTTTCTACAGTCGAGTTCCCTTGCACTGAACCATCGATCAAAACTGATCTCGATGCGCCTATTGAGAGGAGGAGGTCAAGACCACCTTATGGTGGTAGAAGTAGGTTGGTTAACTCTCAGCTCAATAACACCATCAGAACGATGAATGTCGACCCTGAACTTGACGATGGTGGTCTTCGATTCAGTGATCAGCAGTTTCCTTCAGACGAAGATGTCTGCCAAGAAGTTGATGGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

12.48

Weight (kDa)

4.54

Isoelectric Point (pI)

66.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017287)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 314
AccB7I CCANNNNNTGG 1 cut(s) 191
AccI GTMKAC 1 cut(s) 252
AcuI CTGAAG 1 cut(s) 288
AfiI CCNNNNNNNGG 2 cut(s) 191, 194
AflII CTTAAG 1 cut(s) 92
AluBI AGCT 3 cut(s) 20, 59, 223
AluI AGCT 3 cut(s) 20, 59, 223
Alw26I GTCTC 1 cut(s) 9
AspLEI GCGC 1 cut(s) 160
AspS9I GGNCC 1 cut(s) 88
AvaII GGWCC 1 cut(s) 88
BbsI GAAGAC 2 cut(s) 72, 269
BccI CCATC 4 cut(s) 142, 242, 263, 326
BclI TGATCA 1 cut(s) 289
BcoDI GTCTC 1 cut(s) 9
BfmI CTRYAG 1 cut(s) 108
BfrI CTTAAG 1 cut(s) 92
Bme18I GGWCC 1 cut(s) 88
BmgT120I GGNCC 1 cut(s) 88
BmiI GGNNCC 1 cut(s) 89
BmsI GCATC 1 cut(s) 145
BpiI GAAGAC 2 cut(s) 72, 269
Bsa29I ATCGAT 1 cut(s) 137
Bsc4I CCNNNNNNNGG 2 cut(s) 191, 194
BseCI ATCGAT 1 cut(s) 137
BseLI CCNNNNNNNGG 2 cut(s) 191, 194
BseMII CTCAG 1 cut(s) 233
BseRI GAGGAG 2 cut(s) 184, 187
BshVI ATCGAT 1 cut(s) 137
BslI CCNNNNNNNGG 2 cut(s) 191, 194
BsmAI GTCTC 1 cut(s) 9
Bsp143I GATC 3 cut(s) 138, 148, 289
BspCNI CTCAG 1 cut(s) 232
BspDI ATCGAT 1 cut(s) 137
BspLI GGNNCC 1 cut(s) 89
BspTI CTTAAG 1 cut(s) 92
BssMI GATC 3 cut(s) 138, 148, 289
Bst4CI ACNGT 1 cut(s) 112
BstAFI CTTAAG 1 cut(s) 92
BstDEI CTNAG 1 cut(s) 219
BstHHI GCGC 1 cut(s) 160
BstKTI GATC 3 cut(s) 141, 151, 292
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 3 cut(s) 138, 148, 289
BstSFI CTRYAG 1 cut(s) 108
BstV2I GAAGAC 2 cut(s) 72, 269
Bsu15I ATCGAT 1 cut(s) 137
BsuTUI ATCGAT 1 cut(s) 137
BtsIMutI CAGTG 2 cut(s) 126, 292
CfoI GCGC 1 cut(s) 160
Cfr13I GGNCC 1 cut(s) 88
ClaI ATCGAT 1 cut(s) 137
CviAII CATG 1 cut(s) 84
CviJI RGCY 3 cut(s) 20, 59, 223
CviKI_1 RGCY 3 cut(s) 20, 59, 223
DdeI CTNAG 1 cut(s) 219
DpnI GATC 3 cut(s) 140, 150, 291
DpnII GATC 3 cut(s) 138, 148, 289
DrdI GACNNNNNNGTC 1 cut(s) 314
DseDI GACNNNNNNGTC 1 cut(s) 314
Eco47I GGWCC 1 cut(s) 88
Eco57I CTGAAG 1 cut(s) 288
EcoO109I RGGNCCY 1 cut(s) 88
FaeI CATG 1 cut(s) 87
FaiI YATR 5 cut(s) 17, 24, 71, 85, 192
FalI AAGNNNNNCTT 2 cut(s) 172, 204
FatI CATG 1 cut(s) 83
FbaI TGATCA 1 cut(s) 289
FblI GTMKAC 1 cut(s) 252
GlaI GCGC 1 cut(s) 159
HhaI GCGC 1 cut(s) 160
Hin1II CATG 1 cut(s) 87
Hin6I GCGC 1 cut(s) 158
HinP1I GCGC 1 cut(s) 158
HincII GTYRAC 2 cut(s) 214, 253
HindII GTYRAC 2 cut(s) 214, 253
HinfI GANTC 1 cut(s) 282
HpaI GTTAAC 1 cut(s) 214
Hpy166II GTNNAC 2 cut(s) 214, 253
Hpy188I TCNGA 2 cut(s) 239, 307
Hpy188III TCNNGA 2 cut(s) 152, 180
Hpy8I GTNNAC 2 cut(s) 214, 253
HpyAV CCTTC 2 cut(s) 52, 312
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4IV ACGT 2 cut(s) 12, 98
HpyCH4V TGCA 1 cut(s) 126
HpyF3I CTNAG 1 cut(s) 219
HpySE526I ACGT 2 cut(s) 12, 98
Hsp92II CATG 1 cut(s) 87
HspAI GCGC 1 cut(s) 158
Ksp22I TGATCA 1 cut(s) 289
KspAI GTTAAC 1 cut(s) 214
Kzo9I GATC 3 cut(s) 138, 148, 289
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 1 cut(s) 270
LweI GCATC 1 cut(s) 145
MaeII ACGT 2 cut(s) 12, 98
MaeIII GTNAC 1 cut(s) 28
MalI GATC 3 cut(s) 140, 150, 291
MboI GATC 3 cut(s) 138, 148, 289
MboII GAAGA 3 cut(s) 72, 269, 323
MluCI AATT 1 cut(s) 49
MmeI TCCRAC 1 cut(s) 86
MnlI CCTC 3 cut(s) 162, 165, 168
MseI TTAA 3 cut(s) 9, 93, 213
MspCI CTTAAG 1 cut(s) 92
NdeII GATC 3 cut(s) 138, 148, 289
NlaIII CATG 1 cut(s) 87
NlaIV GGNNCC 1 cut(s) 89
PfeI GAWTC 1 cut(s) 282
PflMI CCANNNNNTGG 1 cut(s) 191
PpuMI RGGWCCY 1 cut(s) 88
Psp5II RGGWCCY 1 cut(s) 88
PspN4I GGNNCC 1 cut(s) 89
PspPI GGNCC 1 cut(s) 88
PspPPI RGGWCCY 1 cut(s) 88
SalI GTCGAC 1 cut(s) 251
SaqAI TTAA 3 cut(s) 9, 93, 213
Sau3AI GATC 3 cut(s) 138, 148, 289
Sau96I GGNCC 1 cut(s) 88
SetI ASST 8 cut(s) 15, 22, 61, 101, 179, 190, 209, 225
SfaNI GCATC 1 cut(s) 145
SfcI CTRYAG 1 cut(s) 108
SgeI CNNG 8 cut(s) 96, 127, 135, 164, 192, 269, 275, 335
SinI GGWCC 1 cut(s) 88
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 1 cut(s) 49
TaaI ACNGT 1 cut(s) 112
TaiI ACGT 2 cut(s) 15, 101
TaqI TCGA 5 cut(s) 114, 137, 153, 252, 280
TasI AATT 1 cut(s) 49
TfiI GAWTC 1 cut(s) 282
Tru1I TTAA 3 cut(s) 9, 93, 213
Tru9I TTAA 3 cut(s) 9, 93, 213
TscAI CASTG 2 cut(s) 133, 292
TspDTI ATGAA 2 cut(s) 72, 260
TspRI CASTG 2 cut(s) 133, 292
Van91I CCANNNNNTGG 1 cut(s) 191
Vha464I CTTAAG 1 cut(s) 92
VpaK11BI GGWCC 1 cut(s) 88
XcmI CCANNNNNNNNNTGG 1 cut(s) 329
XmiI GTMKAC 1 cut(s) 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.