MD03G1122200.v1.1

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
Physical Location & Seq
Forward (+)
11397959 .. 11398316
358 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1122200.v1.1.491

Sequence Viewer

Length: 168 bp
ATGGTGAAGACTTCAAATGAACACGGTGGATATCGACTTGACCGACACCTGGATGAGGATGGGAAGCAAGTAGTGTATCCGGGAAGCACTGTGAACAACCACCATTACATCCCCAGGCCGGACTTCAACAGCAAGGGTGGTGGTGACAACGACAATGGCGTTCGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.15

Weight (kDa)

6.38

Isoelectric Point (pI)

18.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018497)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 3 cut(s) 49, 55, 118
AgsI TTSAA 2 cut(s) 15, 127
AjnI CCWGG 2 cut(s) 48, 113
AoxI GGCC 1 cut(s) 116
AsuC2I CCSGG 1 cut(s) 81
AsuHPI GGTGA 2 cut(s) 16, 155
BbsI GAAGAC 1 cut(s) 14
BccI CCATC 1 cut(s) 53
BciT130I CCWGG 2 cut(s) 50, 115
BciVI GTATCC 1 cut(s) 87
BcnI CCSGG 1 cut(s) 81
BfuI GTATCC 1 cut(s) 87
Bme1390I CCNGG 3 cut(s) 50, 81, 115
BmrFI CCNGG 3 cut(s) 50, 81, 115
BpiI GAAGAC 1 cut(s) 14
BpuMI CCSGG 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 113
Bsc4I CCNNNNNNNGG 3 cut(s) 49, 55, 118
BseBI CCWGG 2 cut(s) 50, 115
BseDI CCNNGG 1 cut(s) 113
BseGI GGATG 3 cut(s) 58, 64, 108
BseLI CCNNNNNNNGG 3 cut(s) 49, 55, 118
BshFI GGCC 1 cut(s) 118
BsiSI CCGG 2 cut(s) 80, 119
BslI CCNNNNNNNGG 3 cut(s) 49, 55, 118
BsnI GGCC 1 cut(s) 118
BspANI GGCC 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 113
Bst2UI CCWGG 2 cut(s) 50, 115
Bst4CI ACNGT 2 cut(s) 26, 91
BstENI CCTNNNNNAGG 1 cut(s) 53
BstF5I GGATG 3 cut(s) 58, 64, 108
BstNI CCWGG 2 cut(s) 50, 115
BstSCI CCNGG 3 cut(s) 48, 79, 113
BstV2I GAAGAC 1 cut(s) 14
BsuI GTATCC 1 cut(s) 87
BsuRI GGCC 1 cut(s) 118
BtsCI GGATG 3 cut(s) 58, 64, 108
BtsIMutI CAGTG 1 cut(s) 87
CspCI CAANNNNNGTGG 2 cut(s) 121, 156
CviJI RGCY 1 cut(s) 118
CviKI_1 RGCY 1 cut(s) 118
Eco32I GATATC 1 cut(s) 32
EcoNI CCTNNNNNAGG 1 cut(s) 53
EcoRII CCWGG 2 cut(s) 48, 113
EcoRV GATATC 1 cut(s) 32
FokI GGATG 3 cut(s) 65, 71, 95
HaeIII GGCC 1 cut(s) 118
HapII CCGG 2 cut(s) 80, 119
HpaII CCGG 2 cut(s) 80, 119
HphI GGTGA 2 cut(s) 16, 155
Hpy166II GTNNAC 1 cut(s) 94
Hpy8I GTNNAC 1 cut(s) 94
HpyCH4III ACNGT 2 cut(s) 26, 91
LpnPI CCDG 6 cut(s) 35, 62, 93, 100, 127, 132
MaeIII GTNAC 1 cut(s) 143
MboII GAAGA 1 cut(s) 19
MnlI CCTC 1 cut(s) 49
MslI CAYNNNNRTG 1 cut(s) 51
MspI CCGG 2 cut(s) 80, 119
MspR9I CCNGG 3 cut(s) 50, 81, 115
MvaI CCWGG 2 cut(s) 50, 115
NciI CCSGG 1 cut(s) 81
NmuCI GTSAC 1 cut(s) 143
PcsI WCGNNNNNNNCGW 2 cut(s) 40, 156
PfoI TCCNGGA 1 cut(s) 79
Psp6I CCWGG 2 cut(s) 48, 113
PspGI CCWGG 2 cut(s) 48, 113
RseI CAYNNNNRTG 1 cut(s) 51
ScrFI CCNGG 3 cut(s) 50, 81, 115
SetI ASST 1 cut(s) 51
SmiMI CAYNNNNRTG 1 cut(s) 51
StyD4I CCNGG 3 cut(s) 48, 79, 113
TaaI ACNGT 2 cut(s) 26, 91
TaqI TCGA 1 cut(s) 34
TaqII GACCGA 1 cut(s) 57
TscAI CASTG 1 cut(s) 94
TseFI GTSAC 1 cut(s) 143
Tsp45I GTSAC 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 33
TspRI CASTG 1 cut(s) 94
XagI CCTNNNNNAGG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.