Rroxscaffold_1G00022210

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0018497
Physical Location & Seq
Forward (+)
27351749 .. 27351970
222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00022210.1

Sequence Viewer

Length: 222 bp
ATGAGATTCCTGGCTATTTCCCTAATTTTGATGATGATGAGCTCTGCATTTGCTGGTCGGCAACTTGATGATGATCGGCATGGTATCCGACAGCTAGTTCAGGAGACCAAGACCGTCGATCAAGCTGGGTATCCTGGAACCAGTGTGAATAACCACCATTACATCCCTAGGCAGGACTTTAACAGCAAGGGTGGCAGTGATGGTGGGAATGGCAGTGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.01

Weight (kDa)

6.24

Isoelectric Point (pI)

31.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018497)

Species Orthologous Gene IDs
malus_domestica MD03G1122100.v1.1 MD03G1122200.v1.1
prunus_persica Prupe.6G105000_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0058381
rosa_multiflora Rmu_sc0001849.1_g000013
rosa_roxburghii Rroxscaffold_1G00022210 Rroxscaffold_1G00022740
rosa_rugosa Rorug05G0313500
rosa_samantha Rh5DG403000 Rh5DG407400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 172
AjnI CCWGG 2 cut(s) 9, 133
AluBI AGCT 3 cut(s) 42, 94, 125
AluI AGCT 3 cut(s) 42, 94, 125
Alw21I GWGCWC 1 cut(s) 44
Alw26I GTCTC 1 cut(s) 98
AspA2I CCTAGG 1 cut(s) 167
AvrII CCTAGG 1 cut(s) 167
BanII GRGCYC 1 cut(s) 44
Bbv12I GWGCWC 1 cut(s) 44
BccI CCATC 1 cut(s) 194
BciT130I CCWGG 2 cut(s) 11, 135
BciVI GTATCC 2 cut(s) 95, 141
BcoDI GTCTC 1 cut(s) 98
BfaI CTAG 2 cut(s) 95, 168
BfuI GTATCC 2 cut(s) 95, 141
BlnI CCTAGG 1 cut(s) 167
Bme1390I CCNGG 2 cut(s) 11, 135
BmiI GGNNCC 1 cut(s) 139
BmrFI CCNGG 2 cut(s) 11, 135
BsaBI GATNNNNATC 1 cut(s) 72
BsaI GGTCTC 1 cut(s) 98
BsaJI CCNNGG 1 cut(s) 167
Bsc4I CCNNNNNNNGG 1 cut(s) 172
Bse1I ACTGG 1 cut(s) 141
Bse8I GATNNNNATC 1 cut(s) 72
BseBI CCWGG 2 cut(s) 11, 135
BseDI CCNNGG 1 cut(s) 167
BseGI GGATG 1 cut(s) 162
BseJI GATNNNNATC 1 cut(s) 72
BseLI CCNNNNNNNGG 1 cut(s) 172
BseNI ACTGG 1 cut(s) 141
BseYI CCCAGC 1 cut(s) 125
BsiHKAI GWGCWC 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 172
BsmAI GTCTC 1 cut(s) 98
Bso31I GGTCTC 1 cut(s) 98
Bsp1286I GDGCHC 1 cut(s) 44
Bsp143I GATC 2 cut(s) 73, 118
BspLI GGNNCC 1 cut(s) 139
BspTNI GGTCTC 1 cut(s) 98
BsrI ACTGG 1 cut(s) 141
BssECI CCNNGG 1 cut(s) 167
BssMI GATC 2 cut(s) 73, 118
BssT1I CCWWGG 1 cut(s) 167
Bst2UI CCWGG 2 cut(s) 11, 135
Bst4CI ACNGT 1 cut(s) 115
BstF5I GGATG 1 cut(s) 162
BstKTI GATC 2 cut(s) 76, 121
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 2 cut(s) 73, 118
BstMWI GCNNNNNNNGC 1 cut(s) 192
BstNI CCWGG 2 cut(s) 11, 135
BstSCI CCNGG 2 cut(s) 9, 133
BsuI GTATCC 2 cut(s) 95, 141
BtsCI GGATG 1 cut(s) 162
BtsI GCAGTG 2 cut(s) 202, 220
BtsIMutI CAGTG 3 cut(s) 148, 202, 220
CviAII CATG 1 cut(s) 80
CviJI RGCY 4 cut(s) 14, 42, 94, 125
CviKI_1 RGCY 4 cut(s) 14, 42, 94, 125
DpnI GATC 2 cut(s) 75, 120
DpnII GATC 2 cut(s) 73, 118
Ecl136II GAGCTC 1 cut(s) 42
Eco130I CCWWGG 1 cut(s) 167
Eco24I GRGCYC 1 cut(s) 44
Eco31I GGTCTC 1 cut(s) 98
Eco53kI GAGCTC 1 cut(s) 42
EcoICRI GAGCTC 1 cut(s) 42
EcoRII CCWGG 2 cut(s) 9, 133
EcoT14I CCWWGG 1 cut(s) 167
EcoT38I GRGCYC 1 cut(s) 44
ErhI CCWWGG 1 cut(s) 167
FaeI CATG 1 cut(s) 83
FaiI YATR 1 cut(s) 81
FatI CATG 1 cut(s) 79
FokI GGATG 1 cut(s) 149
FriOI GRGCYC 1 cut(s) 44
FspBI CTAG 2 cut(s) 95, 168
GsaI CCCAGC 1 cut(s) 129
Hin1II CATG 1 cut(s) 83
HinfI GANTC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 89
Hpy188III TCNNGA 1 cut(s) 101
Hpy99I CGWCG 1 cut(s) 119
HpyCH4III ACNGT 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 47
HpyF10VI GCNNNNNNNGC 1 cut(s) 192
Hsp92II CATG 1 cut(s) 83
Kzo9I GATC 2 cut(s) 73, 118
LpnPI CCDG 8 cut(s) 23, 39, 86, 111, 120, 147, 154, 158
MaeI CTAG 2 cut(s) 95, 168
MaeIII GTNAC 1 cut(s) 215
MalI GATC 2 cut(s) 75, 120
MboI GATC 2 cut(s) 73, 118
MhlI GDGCHC 1 cut(s) 44
MluCI AATT 1 cut(s) 24
MmeI TCCRAC 1 cut(s) 112
MseI TTAA 1 cut(s) 180
MspR9I CCNGG 2 cut(s) 11, 135
MvaI CCWGG 2 cut(s) 11, 135
MwoI GCNNNNNNNGC 1 cut(s) 192
NdeII GATC 2 cut(s) 73, 118
NlaIII CATG 1 cut(s) 83
NlaIV GGNNCC 1 cut(s) 139
NmuCI GTSAC 1 cut(s) 215
PfeI GAWTC 1 cut(s) 6
PfoI TCCNGGA 1 cut(s) 133
Psp124BI GAGCTC 1 cut(s) 44
Psp6I CCWGG 2 cut(s) 9, 133
PspFI CCCAGC 1 cut(s) 125
PspGI CCWGG 2 cut(s) 9, 133
PspN4I GGNNCC 1 cut(s) 139
SacI GAGCTC 1 cut(s) 44
SaqAI TTAA 1 cut(s) 180
Sau3AI GATC 2 cut(s) 73, 118
ScrFI CCNGG 2 cut(s) 11, 135
SduI GDGCHC 1 cut(s) 44
SetI ASST 3 cut(s) 44, 96, 127
Sse9I AATT 1 cut(s) 24
SspMI CTAG 2 cut(s) 95, 168
SstI GAGCTC 1 cut(s) 44
StyD4I CCNGG 2 cut(s) 9, 133
StyI CCWWGG 1 cut(s) 167
TaaI ACNGT 1 cut(s) 115
TaqI TCGA 1 cut(s) 117
TasI AATT 1 cut(s) 24
TfiI GAWTC 1 cut(s) 6
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TscAI CASTG 3 cut(s) 148, 202, 220
TseFI GTSAC 1 cut(s) 215
Tsp45I GTSAC 1 cut(s) 215
TspRI CASTG 3 cut(s) 148, 202, 220
XmaJI CCTAGG 1 cut(s) 167
XspI CTAG 2 cut(s) 95, 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.