Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr03

Orthogroup ID

OG0019766

Physical Location & Seq

Genomic Coordinates Reverse (-)

34056087 .. 34057529

Gene Structure 1443 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD03G1253800.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

ATGCCACTCATCATCCATTGGACAACAAAATGGTTTGAGGAACATGAGCATAAATGGAATGTGAGCAATAATCCACCAGACATCGTGCCTCTTTGTTTGTTGTCACATCTCCAGACCATCTCCATAAGGTGTTTCAAGGGTCAGCGAGATGAGATGGAAGTTGCTAAATACTTTTTGAAGAATGGCAAAGTTTTAAATAAGATGACTATTCATACACTTCTCCTAGAACACATAAATTTTTGTGTTCGGAAGATGAGATGTGCAGGAAAATCTCAACATTTGAAAAGGGTTCAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBD LRR_2

Protein Analysis

99

Amino Acids

11.68

Weight (kDa)

9.55

Isoelectric Point (pI)

33.5

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
FBD	PF08387	26 - 70	1.8e-18	FBD

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019766)

Species	Orthologous Gene IDs
malus_domestica	MD03G1112300.v1.1 MD03G1253800.v1.1
rosa_chinensis	RchiOBHm_Chr1g0382511
rosa_samantha	Rh1AG460100 Rh1BG416300 Rh1CG430100 Rh1DG448700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	235
AgsI	TTSAA	4 cut(s)	136, 178, 283, 293
ApoI	RAATTY	1 cut(s)	235
BccI	CCATC	2 cut(s)	125, 148
BfaI	CTAG	1 cut(s)	224
BpmI	CTGGAG	1 cut(s)	95
BseGI	GGATG	1 cut(s)	12
BsgI	GTGCAG	1 cut(s)	282
BstF5I	GGATG	1 cut(s)	12
BtsCI	GGATG	1 cut(s)	12
CviAII	CATG	1 cut(s)	44
DraI	TTTAAA	1 cut(s)	195
FaeI	CATG	1 cut(s)	47
FaiI	YATR	5 cut(s)	45, 51, 125, 213, 233
FatI	CATG	1 cut(s)	43
FspBI	CTAG	1 cut(s)	224
GsuI	CTGGAG	1 cut(s)	95
Hin1II	CATG	1 cut(s)	47
Hpy188I	TCNGA	1 cut(s)	249
Hpy188III	TCNNGA	1 cut(s)	112
HpyCH4V	TGCA	1 cut(s)	263
Hsp92II	CATG	1 cut(s)	47
LpnPI	CCDG	3 cut(s)	90, 125, 249
MaeI	CTAG	1 cut(s)	224
MaeIII	GTNAC	1 cut(s)	102
MboII	GAAGA	2 cut(s)	190, 262
MluCI	AATT	1 cut(s)	235
MnlI	CCTC	2 cut(s)	31, 99
MseI	TTAA	1 cut(s)	194
NlaIII	CATG	1 cut(s)	47
NmuCI	GTSAC	1 cut(s)	102
SaqAI	TTAA	1 cut(s)	194
SetI	ASST	1 cut(s)	131
SgeI	CNNG	8 cut(s)	56, 89, 97, 124, 148, 158, 236, 276
Sse9I	AATT	1 cut(s)	235
SspMI	CTAG	1 cut(s)	224
TasI	AATT	1 cut(s)	235
Tru1I	TTAA	1 cut(s)	194
Tru9I	TTAA	1 cut(s)	194
TseFI	GTSAC	1 cut(s)	102
Tsp45I	GTSAC	1 cut(s)	102
TspDTI	ATGAA	1 cut(s)	200
XapI	RAATTY	1 cut(s)	235
XspI	CTAG	1 cut(s)	224

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.