Rh1BG416300

LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0019766
Physical Location & Seq
Reverse (-)
53846811 .. 53848283
1473 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG416300.1

Sequence Viewer

Length: 267 bp
ATGAATTTGTTCATTGCTCCTAATCTGGAAGACATTGTCCTAGAAGACAGAACTAAAGATGACAGAGAATATTCAGAGCTTCATTGGAATCCACCAGAGGTTGTGCCTAGTTGTTTGTTGTCACACCTCAAGACTATCTCCATTCATGGATTCAAGGGACAGAGGATTGAGATAGAAGTGACAAAGTATTTGCTGTTCAATGGTTATCTCTTGAATAAGTTGACAATCACGTATAGTATAGATCTTTCGGGTGAGGAAAATAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

88

Amino Acids

10.21

Weight (kDa)

4.86

Isoelectric Point (pI)

40.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FBD PF08387 32 - 76 1.6e-14 FBD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019766)

Species Orthologous Gene IDs
malus_domestica MD03G1112300.v1.1 MD03G1253800.v1.1
rosa_chinensis RchiOBHm_Chr1g0382511
rosa_samantha Rh1AG460100 Rh1BG416300 Rh1CG430100 Rh1DG448700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 4
AgsI TTSAA 3 cut(s) 154, 199, 214
AluBI AGCT 1 cut(s) 79
AluI AGCT 1 cut(s) 79
ApoI RAATTY 1 cut(s) 4
ArsI GACNNNNNNTTYG 2 cut(s) 172, 204
Asp700I GAANNNNTTC 1 cut(s) 8
AsuHPI GGTGA 1 cut(s) 263
BbsI GAAGAC 2 cut(s) 36, 51
BfaI CTAG 2 cut(s) 41, 108
BglII AGATCT 1 cut(s) 241
BpiI GAAGAC 2 cut(s) 36, 51
BpuEI CTTGAG 1 cut(s) 113
BsaAI YACGTR 1 cut(s) 231
Bse3DI GCAATG 1 cut(s) 12
BseMI GCAATG 1 cut(s) 12
BslFI GGGAC 1 cut(s) 171
BsmFI GGGAC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 241
BsrDI GCAATG 1 cut(s) 12
BssMI GATC 1 cut(s) 241
BstBAI YACGTR 1 cut(s) 231
BstKTI GATC 1 cut(s) 244
BstMBI GATC 1 cut(s) 241
BstV2I GAAGAC 2 cut(s) 36, 51
BstX2I RGATCY 1 cut(s) 241
BstYI RGATCY 1 cut(s) 241
CviAII CATG 1 cut(s) 146
CviJI RGCY 1 cut(s) 79
CviKI_1 RGCY 1 cut(s) 79
DpnI GATC 1 cut(s) 243
DpnII GATC 1 cut(s) 241
FaeI CATG 1 cut(s) 149
FaiI YATR 3 cut(s) 147, 234, 239
FaqI GGGAC 1 cut(s) 171
FatI CATG 1 cut(s) 145
FspBI CTAG 2 cut(s) 41, 108
Hin1II CATG 1 cut(s) 149
HincII GTYRAC 1 cut(s) 222
HindII GTYRAC 1 cut(s) 222
HinfI GANTC 2 cut(s) 88, 150
HphI GGTGA 1 cut(s) 263
Hpy166II GTNNAC 1 cut(s) 222
Hpy188I TCNGA 1 cut(s) 76
Hpy188III TCNNGA 3 cut(s) 26, 130, 211
Hpy8I GTNNAC 1 cut(s) 222
HpyCH4IV ACGT 1 cut(s) 230
HpySE526I ACGT 1 cut(s) 230
Hsp92II CATG 1 cut(s) 149
Kzo9I GATC 1 cut(s) 241
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 2 cut(s) 11, 108
MaeI CTAG 2 cut(s) 41, 108
MaeII ACGT 1 cut(s) 230
MaeIII GTNAC 2 cut(s) 120, 178
MalI GATC 1 cut(s) 243
MboI GATC 1 cut(s) 241
MboII GAAGA 2 cut(s) 41, 56
MflI RGATCY 1 cut(s) 241
MluCI AATT 2 cut(s) 4, 262
MnlI CCTC 4 cut(s) 91, 137, 156, 247
MroXI GAANNNNTTC 1 cut(s) 8
NdeII GATC 1 cut(s) 241
NlaIII CATG 1 cut(s) 149
NmuCI GTSAC 2 cut(s) 120, 178
PdmI GAANNNNTTC 1 cut(s) 8
PfeI GAWTC 2 cut(s) 88, 150
PflFI GACNNNGTC 1 cut(s) 35
Ppu21I YACGTR 1 cut(s) 231
PsrI GAACNNNNNNTAC 2 cut(s) 179, 211
PsuI RGATCY 1 cut(s) 241
PsyI GACNNNGTC 1 cut(s) 35
Sau3AI GATC 1 cut(s) 241
SetI ASST 4 cut(s) 81, 102, 129, 233
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
Sse9I AATT 2 cut(s) 4, 262
SspI AATATT 1 cut(s) 71
SspMI CTAG 2 cut(s) 41, 108
TaiI ACGT 1 cut(s) 233
TasI AATT 2 cut(s) 4, 262
TfiI GAWTC 2 cut(s) 88, 150
TseFI GTSAC 2 cut(s) 120, 178
Tsp45I GTSAC 2 cut(s) 120, 178
TspDTI ATGAA 3 cut(s) 17, 71, 134
Tth111I GACNNNGTC 1 cut(s) 35
XapI RAATTY 1 cut(s) 4
XmnI GAANNNNTTC 1 cut(s) 8
XspI CTAG 2 cut(s) 41, 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.