Rh1DG448700

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
65754783 .. 65755350
568 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG448700.1

Sequence Viewer

Length: 345 bp
ATGGACTTGTACTTGATCTTGCAATTCGGCTTCTGGCTCAAATTTCTGAGGTTAAGTATGTCTCTCTCTCGGCTTATGTTTTGGAGCAGCATTGCTCCTAATCTGGAAGACATTGTCCTAGAAGACAGAACTAAAGATGACAGAGAATATTCAGAGCTTCATTGGAATCCACCAGAGGTTGTGCCTAGTTGTTTGTTGTCACACCTCAAGACTATCTCCATTCATGGATTCAAGGGACAGAGGATTGAGATAGAAGTGACAAAGTATTTGCTGTTCAATGGTTATCTCTTGAATAAGTTGACAATCACGTATAGTATAGATCTTTCGGGTGAGGAAAATAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

13.41

Weight (kDa)

5.28

Isoelectric Point (pI)

46.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FBD PF08387 58 - 102 2.9e-14 FBD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019766)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 41
AfaI GTAC 1 cut(s) 11
AgsI TTSAA 3 cut(s) 232, 277, 292
AluBI AGCT 1 cut(s) 157
AluI AGCT 1 cut(s) 157
Alw26I GTCTC 1 cut(s) 66
ApeKI GCWGC 1 cut(s) 87
ApoI RAATTY 1 cut(s) 41
ArsI GACNNNNNNTTYG 2 cut(s) 250, 282
AsuHPI GGTGA 1 cut(s) 341
BbsI GAAGAC 2 cut(s) 114, 129
BbvI GCAGC 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 66
BfaI CTAG 2 cut(s) 119, 186
BglII AGATCT 1 cut(s) 319
BisI GCNGC 1 cut(s) 88
BlsI GCNGC 1 cut(s) 89
BpiI GAAGAC 2 cut(s) 114, 129
BpuEI CTTGAG 1 cut(s) 191
BsaAI YACGTR 1 cut(s) 309
Bse3DI GCAATG 1 cut(s) 90
BseMI GCAATG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 38
BseXI GCAGC 1 cut(s) 99
BslFI GGGAC 1 cut(s) 249
BsmAI GTCTC 1 cut(s) 66
BsmFI GGGAC 1 cut(s) 249
Bsp143I GATC 2 cut(s) 15, 319
BspCNI CTCAG 1 cut(s) 39
BsrDI GCAATG 1 cut(s) 90
BssMI GATC 2 cut(s) 15, 319
BstBAI YACGTR 1 cut(s) 309
BstDEI CTNAG 1 cut(s) 47
BstKTI GATC 2 cut(s) 18, 322
BstMAI GTCTC 1 cut(s) 66
BstMBI GATC 2 cut(s) 15, 319
BstV1I GCAGC 1 cut(s) 99
BstV2I GAAGAC 2 cut(s) 114, 129
BstX2I RGATCY 1 cut(s) 319
BstYI RGATCY 1 cut(s) 319
Csp6I GTAC 1 cut(s) 10
CviAII CATG 1 cut(s) 224
CviJI RGCY 4 cut(s) 30, 37, 73, 157
CviKI_1 RGCY 4 cut(s) 30, 37, 73, 157
CviQI GTAC 1 cut(s) 10
DdeI CTNAG 1 cut(s) 47
DpnI GATC 2 cut(s) 17, 321
DpnII GATC 2 cut(s) 15, 319
FaeI CATG 1 cut(s) 227
FaiI YATR 5 cut(s) 59, 77, 225, 312, 317
FaqI GGGAC 1 cut(s) 249
FatI CATG 1 cut(s) 223
Fnu4HI GCNGC 1 cut(s) 88
Fsp4HI GCNGC 1 cut(s) 88
FspBI CTAG 2 cut(s) 119, 186
GluI GCNGC 1 cut(s) 88
Hin1II CATG 1 cut(s) 227
HincII GTYRAC 1 cut(s) 300
HindII GTYRAC 1 cut(s) 300
HinfI GANTC 2 cut(s) 166, 228
HphI GGTGA 1 cut(s) 341
Hpy166II GTNNAC 1 cut(s) 300
Hpy188I TCNGA 2 cut(s) 48, 154
Hpy188III TCNNGA 3 cut(s) 104, 208, 289
Hpy8I GTNNAC 1 cut(s) 300
HpyCH4IV ACGT 1 cut(s) 308
HpyCH4V TGCA 1 cut(s) 22
HpyF3I CTNAG 1 cut(s) 47
HpySE526I ACGT 1 cut(s) 308
Hsp92II CATG 1 cut(s) 227
Kzo9I GATC 2 cut(s) 15, 319
LmnI GCTCC 2 cut(s) 84, 100
LpnPI CCDG 3 cut(s) 19, 89, 186
Lsp1109I GCAGC 1 cut(s) 99
MaeI CTAG 2 cut(s) 119, 186
MaeII ACGT 1 cut(s) 308
MaeIII GTNAC 2 cut(s) 198, 256
MalI GATC 2 cut(s) 17, 321
MboI GATC 2 cut(s) 15, 319
MboII GAAGA 2 cut(s) 119, 134
MflI RGATCY 1 cut(s) 319
MluCI AATT 3 cut(s) 23, 41, 340
MnlI CCTC 5 cut(s) 42, 169, 215, 234, 325
MseI TTAA 1 cut(s) 53
NdeII GATC 2 cut(s) 15, 319
NlaIII CATG 1 cut(s) 227
NmeAIII GCCGAG 1 cut(s) 49
NmuCI GTSAC 2 cut(s) 198, 256
PfeI GAWTC 2 cut(s) 166, 228
PflFI GACNNNGTC 1 cut(s) 113
PkrI GCNGC 1 cut(s) 89
Ppu21I YACGTR 1 cut(s) 309
PsrI GAACNNNNNNTAC 2 cut(s) 257, 289
PsuI RGATCY 1 cut(s) 319
PsyI GACNNNGTC 1 cut(s) 113
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
SaqAI TTAA 1 cut(s) 53
SatI GCNGC 1 cut(s) 88
Sau3AI GATC 2 cut(s) 15, 319
SetI ASST 5 cut(s) 53, 159, 180, 207, 311
SmlI CTYRAG 1 cut(s) 206
SmoI CTYRAG 1 cut(s) 206
Sse9I AATT 3 cut(s) 23, 41, 340
SspI AATATT 1 cut(s) 149
SspMI CTAG 2 cut(s) 119, 186
TaiI ACGT 1 cut(s) 311
TasI AATT 3 cut(s) 23, 41, 340
TatI WGTACW 1 cut(s) 9
TfiI GAWTC 2 cut(s) 166, 228
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TseFI GTSAC 2 cut(s) 198, 256
TseI GCWGC 1 cut(s) 87
Tsp45I GTSAC 2 cut(s) 198, 256
TspDTI ATGAA 2 cut(s) 149, 212
Tth111I GACNNNGTC 1 cut(s) 113
XapI RAATTY 1 cut(s) 41
XspI CTAG 2 cut(s) 119, 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.