Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr04

Orthogroup ID

OG0008973

Physical Location & Seq

Genomic Coordinates Forward (+)

22739255 .. 22742707

Gene Structure 3453 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD04G1139000.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 474 bp

ATGGAGGGAAGAAAGCAAACTGGGTCGTCGTCTTCTTCCTTCACTTCTGAGCTTTTCGGATCGAAGGAGTCATCTGCTTCTCCTGGGATTTTTGGGGCCATATTTGCGCCTCCCTCCAAGGATTTGGTGTTAGGGAGGGAATCTGTGCATTCAGAATTCACTGGGAAAAAGCTCTCGGATGAACCATTGCACTTCACGCCCGGAGATCAGCCAGATGGTGCCTCTAAAGAGAGCGAAGGTGAGAGTAAGAGCATATCAAATAAGGACATAATAAACTCCATCTATAGGGATCAGAGAGTGCAACAACCTTGCCATCTCAGTTCGTCAATCTATTATGGTGGCCAAGATATTTATTCTTACTCCCAGAGTAACCAGAGCCCTGAATATAACTCTACGTACAAGAAAGATGGGACCGAGGATGATTCGGGAAGTGCTTGTAGAGGAAACTGGTGGCAAGGTTCCCTCTATTATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

158

Amino Acids

17.19

Weight (kDa)

5.02

Isoelectric Point (pI)

54.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008973)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G02020 AT5G02020
fragaria_vesca	FvH4_6g12720
malus_domestica	MD04G1139000.v1.1 MD12G1154800.v1.1
prunus_persica	Prupe.6G264600_v2.0.a1 Prupe.6G264600_v2.0.a1 Prupe.6G264600_v2.0.a1 Prupe.6G264600_v2.0.a1
pyrus_communis	pycom04g12730 pycom12g14700
rosa_chinensis	RchiOBHm_Chr3g0464641
rosa_laevigata	RLG00000024678
rosa_multiflora	Rmu_sc0002031.1_g000006 Rmu_sc0014550.1_g000014
rosa_roxburghii	Rroxscaffold_6G00415510
rosa_rugosa	Rorug03G0073400.1 Rorug03G0073500
rosa_samantha	Rh3BG135700 Rh3CG138300 Rh3DG137300
rosa_wichuraiana	Rw3G011110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	218
AclWI	GGATC	2 cut(s)	67, 297
AcoI	YGGCCR	1 cut(s)	340
AcsI	RAATTY	1 cut(s)	155
AfaI	GTAC	1 cut(s)	398
AfiI	CCNNNNNNNGG	1 cut(s)	285
AjnI	CCWGG	1 cut(s)	82
AluBI	AGCT	2 cut(s)	52, 172
AluI	AGCT	2 cut(s)	52, 172
AlwI	GGATC	2 cut(s)	67, 297
AoxI	GGCC	2 cut(s)	96, 340
ApoI	RAATTY	1 cut(s)	155
AspLEI	GCGC	1 cut(s)	109
AspS9I	GGNCC	2 cut(s)	96, 411
AsuC2I	CCSGG	1 cut(s)	201
AsuHPI	GGTGA	1 cut(s)	251
AvaII	GGWCC	1 cut(s)	411
BalI	TGGCCA	1 cut(s)	342
BanI	GGYRCC	1 cut(s)	218
BanII	GRGCYC	1 cut(s)	380
BbsI	GAAGAC	1 cut(s)	24
BccI	CCATC	4 cut(s)	209, 287, 321, 401
BciT130I	CCWGG	1 cut(s)	84
BcnI	CCSGG	1 cut(s)	201
BfmI	CTRYAG	1 cut(s)	283
Bme1390I	CCNGG	2 cut(s)	84, 201
Bme18I	GGWCC	1 cut(s)	411
BmgT120I	GGNCC	2 cut(s)	96, 411
BmiI	GGNNCC	4 cut(s)	97, 220, 412, 460
BmrFI	CCNGG	2 cut(s)	84, 201
BmrI	ACTGGG	2 cut(s)	30, 171
BmuI	ACTGGG	2 cut(s)	30, 171
BpiI	GAAGAC	1 cut(s)	24
BpuMI	CCSGG	1 cut(s)	201
BsaAI	YACGTR	1 cut(s)	396
BsaJI	CCNNGG	3 cut(s)	83, 117, 414
Bsc4I	CCNNNNNNNGG	1 cut(s)	285
Bse1I	ACTGG	3 cut(s)	25, 166, 452
Bse3DI	GCAATG	1 cut(s)	185
BseBI	CCWGG	1 cut(s)	84
BseDI	CCNNGG	3 cut(s)	83, 117, 414
BseGI	GGATG	2 cut(s)	184, 424
BseLI	CCNNNNNNNGG	1 cut(s)	285
BseMI	GCAATG	1 cut(s)	185
BseMII	CTCAG	2 cut(s)	39, 331
BseNI	ACTGG	3 cut(s)	25, 166, 452
BshFI	GGCC	2 cut(s)	98, 342
BshNI	GGYRCC	1 cut(s)	218
BsiSI	CCGG	1 cut(s)	201
BslFI	GGGAC	1 cut(s)	424
BslI	CCNNNNNNNGG	1 cut(s)	285
BsmFI	GGGAC	1 cut(s)	424
BsmI	GAATGC	1 cut(s)	148
BsnI	GGCC	2 cut(s)	98, 342
Bsp1286I	GDGCHC	1 cut(s)	380
Bsp143I	GATC	3 cut(s)	59, 205, 289
BspANI	GGCC	2 cut(s)	98, 342
BspCNI	CTCAG	2 cut(s)	40, 330
BspLI	GGNNCC	4 cut(s)	97, 220, 412, 460
BspPI	GGATC	2 cut(s)	67, 297
BspT107I	GGYRCC	1 cut(s)	218
BsrDI	GCAATG	1 cut(s)	185
BsrI	ACTGG	3 cut(s)	25, 166, 452
BssECI	CCNNGG	3 cut(s)	83, 117, 414
BssMI	GATC	3 cut(s)	59, 205, 289
BssT1I	CCWWGG	1 cut(s)	117
Bst2UI	CCWGG	1 cut(s)	84
BstBAI	YACGTR	1 cut(s)	396
BstDEI	CTNAG	2 cut(s)	48, 317
BstF5I	GGATG	2 cut(s)	184, 424
BstHHI	GCGC	1 cut(s)	109
BstKTI	GATC	3 cut(s)	62, 208, 292
BstMBI	GATC	3 cut(s)	59, 205, 289
BstMWI	GCNNNNNNNGC	2 cut(s)	104, 196
BstNI	CCWGG	1 cut(s)	84
BstSCI	CCNGG	2 cut(s)	82, 199
BstSFI	CTRYAG	1 cut(s)	283
BstSNI	TACGTA	1 cut(s)	396
BstV2I	GAAGAC	1 cut(s)	24
BstXI	CCANNNNNNTGG	1 cut(s)	124
BsuRI	GGCC	2 cut(s)	98, 342
BtsCI	GGATG	2 cut(s)	184, 424
BtsIMutI	CAGTG	1 cut(s)	159
CfoI	GCGC	1 cut(s)	109
Cfr13I	GGNCC	2 cut(s)	96, 411
Csp6I	GTAC	1 cut(s)	397
CviJI	RGCY	6 cut(s)	52, 98, 172, 211, 342, 378
CviKI_1	RGCY	6 cut(s)	52, 98, 172, 211, 342, 378
CviQI	GTAC	1 cut(s)	397
DdeI	CTNAG	2 cut(s)	48, 317
DpnI	GATC	3 cut(s)	61, 207, 291
DpnII	GATC	3 cut(s)	59, 205, 289
EaeI	YGGCCR	1 cut(s)	340
Eco105I	TACGTA	1 cut(s)	396
Eco130I	CCWWGG	1 cut(s)	117
Eco24I	GRGCYC	1 cut(s)	380
Eco47I	GGWCC	1 cut(s)	411
EcoRI	GAATTC	1 cut(s)	155
EcoRII	CCWGG	1 cut(s)	82
EcoT14I	CCWWGG	1 cut(s)	117
EcoT38I	GRGCYC	1 cut(s)	380
ErhI	CCWWGG	1 cut(s)	117
FaiI	YATR	6 cut(s)	101, 254, 269, 285, 336, 387
FaqI	GGGAC	1 cut(s)	424
FokI	GGATG	2 cut(s)	191, 431
FriOI	GRGCYC	1 cut(s)	380
GlaI	GCGC	1 cut(s)	108
HaeIII	GGCC	2 cut(s)	98, 342
HapII	CCGG	1 cut(s)	201
HhaI	GCGC	1 cut(s)	109
Hin6I	GCGC	1 cut(s)	107
HinP1I	GCGC	1 cut(s)	107
HinfI	GANTC	3 cut(s)	68, 140, 422
HpaII	CCGG	1 cut(s)	201
HphI	GGTGA	1 cut(s)	251
Hpy188I	TCNGA	5 cut(s)	49, 59, 154, 178, 294
Hpy188III	TCNNGA	1 cut(s)	426
Hpy99I	CGWCG	1 cut(s)	31
HpyAV	CCTTC	3 cut(s)	49, 58, 230
HpyCH4IV	ACGT	1 cut(s)	395
HpyCH4V	TGCA	3 cut(s)	148, 190, 301
HpyF10VI	GCNNNNNNNGC	2 cut(s)	104, 196
HpyF3I	CTNAG	2 cut(s)	48, 317
HpySE526I	ACGT	1 cut(s)	395
HspAI	GCGC	1 cut(s)	107
Kzo9I	GATC	3 cut(s)	59, 205, 289
MaeII	ACGT	1 cut(s)	395
MaeIII	GTNAC	1 cut(s)	368
MalI	GATC	3 cut(s)	61, 207, 291
MboI	GATC	3 cut(s)	59, 205, 289
MboII	GAAGA	3 cut(s)	21, 24, 27
MhlI	GDGCHC	1 cut(s)	380
MlsI	TGGCCA	1 cut(s)	342
MluCI	AATT	1 cut(s)	155
MluNI	TGGCCA	1 cut(s)	342
MlyI	GAGTC	1 cut(s)	77
MnlI	CCTC	7 cut(s)	120, 124, 129, 232, 409, 434, 473
Mox20I	TGGCCA	1 cut(s)	342
MscI	TGGCCA	1 cut(s)	342
MseI	TTAA	1 cut(s)	472
Msp20I	TGGCCA	1 cut(s)	342
MspI	CCGG	1 cut(s)	201
MspR9I	CCNGG	2 cut(s)	84, 201
Mva1269I	GAATGC	1 cut(s)	148
MvaI	CCWGG	1 cut(s)	84
MwoI	GCNNNNNNNGC	2 cut(s)	104, 196
NciI	CCSGG	1 cut(s)	201
NdeII	GATC	3 cut(s)	59, 205, 289
NlaIV	GGNNCC	4 cut(s)	97, 220, 412, 460
PctI	GAATGC	1 cut(s)	148
PfeI	GAWTC	2 cut(s)	140, 422
PleI	GAGTC	1 cut(s)	76
PpsI	GAGTC	1 cut(s)	76
Ppu21I	YACGTR	1 cut(s)	396
Psp6I	CCWGG	1 cut(s)	82
PspGI	CCWGG	1 cut(s)	82
PspN4I	GGNNCC	4 cut(s)	97, 220, 412, 460
PspPI	GGNCC	2 cut(s)	96, 411
RsaI	GTAC	1 cut(s)	398
RsaNI	GTAC	1 cut(s)	397
SaqAI	TTAA	1 cut(s)	472
Sau3AI	GATC	3 cut(s)	59, 205, 289
Sau96I	GGNCC	2 cut(s)	96, 411
SchI	GAGTC	1 cut(s)	77
ScrFI	CCNGG	2 cut(s)	84, 201
SduI	GDGCHC	1 cut(s)	380
SetI	ASST	6 cut(s)	54, 174, 241, 310, 398, 460
SfcI	CTRYAG	1 cut(s)	283
SinI	GGWCC	1 cut(s)	411
SnaBI	TACGTA	1 cut(s)	396
Sse9I	AATT	1 cut(s)	155
StyD4I	CCNGG	2 cut(s)	82, 199
StyI	CCWWGG	1 cut(s)	117
TaiI	ACGT	1 cut(s)	398
TaqI	TCGA	1 cut(s)	62
TaqII	GACCGA	1 cut(s)	428
TasI	AATT	1 cut(s)	155
TfiI	GAWTC	2 cut(s)	140, 422
Tru1I	TTAA	1 cut(s)	472
Tru9I	TTAA	1 cut(s)	472
TscAI	CASTG	1 cut(s)	166
TspDTI	ATGAA	1 cut(s)	195
TspRI	CASTG	1 cut(s)	166
VpaK11BI	GGWCC	1 cut(s)	411
XapI	RAATTY	1 cut(s)	155

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.