Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr12

Orthogroup ID

OG0008973

Physical Location & Seq

Genomic Coordinates Forward (+)

23551485 .. 23554868

Gene Structure 3384 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD12G1154800.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 474 bp

ATGGAGGGAAGAAAGAAAACTGGGTCGTCGTCTTCTTCCTTCACCTCTGAGCTTTTCGGGTCGAAGGAGTCATCTGCTTCTTCTGGGATTTTTGGGGCCATATTTGCGCCTTCGTCCAAGGATTTGGTGTTTGGGAGGGAATCTCTGCGTTCTGAAGTCACTGGGAAAAAGCTCACGGATGATCCATTGCACTTCAAGCCCAGAGATCAGCCAGATGGTGCCTCGAAAGAGATCGAAGGTGAGAGTAAGAGCATAACAAATATGGACATAATAAGCTCCATCTATAGGGACCAGAGAGTGCAACAACCTTGCCATTTCAGTTCATCAATCTATTATGGTGGCCAAGATATTTATGCTCACCCCCAGAGTACCCAGAACCCTGAATATAACACTCCGTACAAGAAAGATGGGACCGAGGATGATTCGGGAAGTGCTTCTAGAGGAAACTGGTGGCAAGGGTCCCTCTATTATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

158

Amino Acids

17.35

Weight (kDa)

5.61

Isoelectric Point (pI)

43.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008973)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G02020 AT5G02020
fragaria_vesca	FvH4_6g12720
malus_domestica	MD04G1139000.v1.1 MD12G1154800.v1.1
prunus_persica	Prupe.6G264600_v2.0.a1 Prupe.6G264600_v2.0.a1 Prupe.6G264600_v2.0.a1 Prupe.6G264600_v2.0.a1
pyrus_communis	pycom04g12730 pycom12g14700
rosa_chinensis	RchiOBHm_Chr3g0464641
rosa_laevigata	RLG00000024678
rosa_multiflora	Rmu_sc0002031.1_g000006 Rmu_sc0014550.1_g000014
rosa_roxburghii	Rroxscaffold_6G00415510
rosa_rugosa	Rorug03G0073400.1 Rorug03G0073500
rosa_samantha	Rh3BG135700 Rh3CG138300 Rh3DG137300
rosa_wichuraiana	Rw3G011110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	218
AclWI	GGATC	1 cut(s)	176
AcoI	YGGCCR	1 cut(s)	340
AcuI	CTGAAG	1 cut(s)	174
AfaI	GTAC	2 cut(s)	370, 398
AfiI	CCNNNNNNNGG	1 cut(s)	285
AgsI	TTSAA	1 cut(s)	196
AluBI	AGCT	3 cut(s)	52, 172, 276
AluI	AGCT	3 cut(s)	52, 172, 276
AlwI	GGATC	1 cut(s)	176
AoxI	GGCC	2 cut(s)	96, 340
Asp700I	GAANNNNTTC	1 cut(s)	433
AspLEI	GCGC	1 cut(s)	109
AspS9I	GGNCC	4 cut(s)	96, 289, 411, 459
AsuHPI	GGTGA	3 cut(s)	34, 251, 350
AvaII	GGWCC	3 cut(s)	289, 411, 459
BalI	TGGCCA	1 cut(s)	342
BanI	GGYRCC	1 cut(s)	218
BbsI	GAAGAC	1 cut(s)	24
BccI	CCATC	3 cut(s)	209, 287, 401
BfaI	CTAG	1 cut(s)	438
BfmI	CTRYAG	1 cut(s)	283
Bme18I	GGWCC	3 cut(s)	289, 411, 459
BmgT120I	GGNCC	4 cut(s)	96, 289, 411, 459
BmiI	GGNNCC	6 cut(s)	97, 220, 290, 412, 460, 461
BmrI	ACTGGG	2 cut(s)	30, 171
BmuI	ACTGGG	2 cut(s)	30, 171
BpiI	GAAGAC	1 cut(s)	24
BplI	GAGNNNNNCTC	2 cut(s)	127, 159
BsaJI	CCNNGG	2 cut(s)	117, 414
Bsc4I	CCNNNNNNNGG	1 cut(s)	285
Bse1I	ACTGG	3 cut(s)	25, 166, 452
Bse3DI	GCAATG	1 cut(s)	185
BseDI	CCNNGG	2 cut(s)	117, 414
BseGI	GGATG	2 cut(s)	184, 424
BseLI	CCNNNNNNNGG	1 cut(s)	285
BseMI	GCAATG	1 cut(s)	185
BseMII	CTCAG	1 cut(s)	39
BseNI	ACTGG	3 cut(s)	25, 166, 452
BshFI	GGCC	2 cut(s)	98, 342
BshNI	GGYRCC	1 cut(s)	218
BslFI	GGGAC	3 cut(s)	302, 424, 445
BslI	CCNNNNNNNGG	1 cut(s)	285
BsmFI	GGGAC	3 cut(s)	302, 424, 445
BsnI	GGCC	2 cut(s)	98, 342
Bsp143I	GATC	3 cut(s)	181, 205, 231
BspANI	GGCC	2 cut(s)	98, 342
BspCNI	CTCAG	1 cut(s)	40
BspLI	GGNNCC	6 cut(s)	97, 220, 290, 412, 460, 461
BspPI	GGATC	1 cut(s)	176
BspT107I	GGYRCC	1 cut(s)	218
BsrDI	GCAATG	1 cut(s)	185
BsrI	ACTGG	3 cut(s)	25, 166, 452
BssECI	CCNNGG	2 cut(s)	117, 414
BssMI	GATC	3 cut(s)	181, 205, 231
BssT1I	CCWWGG	1 cut(s)	117
BstDEI	CTNAG	1 cut(s)	48
BstF5I	GGATG	2 cut(s)	184, 424
BstHHI	GCGC	1 cut(s)	109
BstKTI	GATC	3 cut(s)	184, 208, 234
BstMBI	GATC	3 cut(s)	181, 205, 231
BstMWI	GCNNNNNNNGC	2 cut(s)	104, 196
BstSFI	CTRYAG	1 cut(s)	283
BstV2I	GAAGAC	1 cut(s)	24
BstXI	CCANNNNNNTGG	1 cut(s)	124
BsuRI	GGCC	2 cut(s)	98, 342
BtsCI	GGATG	2 cut(s)	184, 424
BtsIMutI	CAGTG	1 cut(s)	159
CfoI	GCGC	1 cut(s)	109
Cfr13I	GGNCC	4 cut(s)	96, 289, 411, 459
Csp6I	GTAC	2 cut(s)	369, 397
CviJI	RGCY	7 cut(s)	52, 98, 172, 199, 211, 276, 342
CviKI_1	RGCY	7 cut(s)	52, 98, 172, 199, 211, 276, 342
CviQI	GTAC	2 cut(s)	369, 397
DdeI	CTNAG	1 cut(s)	48
DpnI	GATC	3 cut(s)	183, 207, 233
DpnII	GATC	3 cut(s)	181, 205, 231
EaeI	YGGCCR	1 cut(s)	340
Eco130I	CCWWGG	1 cut(s)	117
Eco47I	GGWCC	3 cut(s)	289, 411, 459
Eco57I	CTGAAG	1 cut(s)	174
EcoO109I	RGGNCCY	1 cut(s)	459
EcoT14I	CCWWGG	1 cut(s)	117
ErhI	CCWWGG	1 cut(s)	117
FaiI	YATR	8 cut(s)	101, 254, 263, 269, 285, 336, 354, 387
FaqI	GGGAC	3 cut(s)	302, 424, 445
FokI	GGATG	2 cut(s)	191, 431
FspBI	CTAG	1 cut(s)	438
GlaI	GCGC	1 cut(s)	108
HaeIII	GGCC	2 cut(s)	98, 342
HhaI	GCGC	1 cut(s)	109
Hin6I	GCGC	1 cut(s)	107
HinP1I	GCGC	1 cut(s)	107
HinfI	GANTC	3 cut(s)	68, 140, 422
HphI	GGTGA	3 cut(s)	34, 251, 350
Hpy188I	TCNGA	2 cut(s)	49, 154
Hpy188III	TCNNGA	2 cut(s)	426, 438
Hpy99I	CGWCG	1 cut(s)	31
HpyAV	CCTTC	4 cut(s)	49, 58, 120, 230
HpyCH4V	TGCA	2 cut(s)	190, 301
HpyF10VI	GCNNNNNNNGC	2 cut(s)	104, 196
HpyF3I	CTNAG	1 cut(s)	48
HspAI	GCGC	1 cut(s)	107
KflI	GGGWCCC	1 cut(s)	459
Kzo9I	GATC	3 cut(s)	181, 205, 231
LmnI	GCTCC	1 cut(s)	281
MaeI	CTAG	1 cut(s)	438
MaeIII	GTNAC	1 cut(s)	157
MalI	GATC	3 cut(s)	183, 207, 233
MboI	GATC	3 cut(s)	181, 205, 231
MboII	GAAGA	4 cut(s)	21, 24, 27, 72
MlsI	TGGCCA	1 cut(s)	342
MluNI	TGGCCA	1 cut(s)	342
MlyI	GAGTC	1 cut(s)	77
MnlI	CCTC	6 cut(s)	55, 129, 232, 409, 434, 473
Mox20I	TGGCCA	1 cut(s)	342
MroXI	GAANNNNTTC	1 cut(s)	433
MscI	TGGCCA	1 cut(s)	342
MseI	TTAA	1 cut(s)	472
Msp20I	TGGCCA	1 cut(s)	342
MwoI	GCNNNNNNNGC	2 cut(s)	104, 196
NdeII	GATC	3 cut(s)	181, 205, 231
NlaIV	GGNNCC	6 cut(s)	97, 220, 290, 412, 460, 461
NmuCI	GTSAC	1 cut(s)	157
PdmI	GAANNNNTTC	1 cut(s)	433
PfeI	GAWTC	2 cut(s)	140, 422
PleI	GAGTC	1 cut(s)	76
PpsI	GAGTC	1 cut(s)	76
PpuMI	RGGWCCY	1 cut(s)	459
Psp5II	RGGWCCY	1 cut(s)	459
PspN4I	GGNNCC	6 cut(s)	97, 220, 290, 412, 460, 461
PspPI	GGNCC	4 cut(s)	96, 289, 411, 459
PspPPI	RGGWCCY	1 cut(s)	459
RsaI	GTAC	2 cut(s)	370, 398
RsaNI	GTAC	2 cut(s)	369, 397
SaqAI	TTAA	1 cut(s)	472
Sau3AI	GATC	3 cut(s)	181, 205, 231
Sau96I	GGNCC	4 cut(s)	96, 289, 411, 459
SchI	GAGTC	1 cut(s)	77
SetI	ASST	6 cut(s)	47, 54, 174, 241, 278, 310
SfcI	CTRYAG	1 cut(s)	283
SinI	GGWCC	3 cut(s)	289, 411, 459
SspMI	CTAG	1 cut(s)	438
StyI	CCWWGG	1 cut(s)	117
TaqI	TCGA	3 cut(s)	62, 224, 234
TaqII	GACCGA	1 cut(s)	428
TfiI	GAWTC	2 cut(s)	140, 422
Tru1I	TTAA	1 cut(s)	472
Tru9I	TTAA	1 cut(s)	472
TscAI	CASTG	1 cut(s)	166
TseFI	GTSAC	1 cut(s)	157
Tsp45I	GTSAC	1 cut(s)	157
TspDTI	ATGAA	1 cut(s)	312
TspGWI	ACGGA	2 cut(s)	191, 384
TspRI	CASTG	1 cut(s)	166
VpaK11BI	GGWCC	3 cut(s)	289, 411, 459
XbaI	TCTAGA	1 cut(s)	437
XmnI	GAANNNNTTC	1 cut(s)	433
XspI	CTAG	1 cut(s)	438

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.