MD05G1140700.v1.1

Anaphase-promoting complex subunit 11 RING-H2 finger

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Reverse (-)
27129440 .. 27131617
2178 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1140700.v1.1.491

Sequence Viewer

Length: 249 bp
ATGACCCTTCTCTCTTTGCGAATATCTGCTGGGGATTTTAAACAGAGTATGTGGCATGCTGTCGCTTCATGGACATGGGATGCACAAGACGAAACATGTGGGATTTGTAGGATGGCATTTGATGGTTGTTGTCCCGATTGTAAACTCCCTGGGGATGATTGCCCGCTAAGAGGCCGGATTATTGCATTAGGATTTCACTATTCCAGAACTTGCTGTTTCTCTGATTTGCGACAAAGCCTAATGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.18

Weight (kDa)

6.0

Isoelectric Point (pI)

46.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-ANAPC11 PF12861 30 - 66 1e-13 Anaphase-promoting complex subunit 11 RING-H2 finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015826)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 164
AfiI CCNNNNNNNGG 1 cut(s) 170
AflIII ACRYGT 1 cut(s) 95
AjnI CCWGG 1 cut(s) 148
AoxI GGCC 1 cut(s) 172
BccI CCATC 2 cut(s) 106, 116
BciT130I CCWGG 1 cut(s) 150
Bme1390I CCNGG 1 cut(s) 150
BmrFI CCNGG 1 cut(s) 150
BmsI GCATC 1 cut(s) 70
BsaJI CCNNGG 2 cut(s) 148, 149
Bsc4I CCNNNNNNNGG 1 cut(s) 170
BseBI CCWGG 1 cut(s) 150
BseDI CCNNGG 2 cut(s) 148, 149
BseGI GGATG 3 cut(s) 85, 117, 160
BseLI CCNNNNNNNGG 1 cut(s) 170
BseYI CCCAGC 1 cut(s) 29
BshFI GGCC 1 cut(s) 174
BsiSI CCGG 1 cut(s) 175
BslFI GGGAC 1 cut(s) 117
BslI CCNNNNNNNGG 1 cut(s) 170
BsmFI GGGAC 1 cut(s) 117
BsnI GGCC 1 cut(s) 174
BspACI CCGC 1 cut(s) 164
BspANI GGCC 1 cut(s) 174
BssECI CCNNGG 2 cut(s) 148, 149
Bst2UI CCWGG 1 cut(s) 150
BstC8I GCNNGC 2 cut(s) 57, 164
BstDEI CTNAG 1 cut(s) 167
BstF5I GGATG 3 cut(s) 85, 117, 160
BstNI CCWGG 1 cut(s) 150
BstNSI RCATGY 2 cut(s) 59, 99
BstSCI CCNGG 1 cut(s) 148
BsuRI GGCC 1 cut(s) 174
BtsCI GGATG 3 cut(s) 85, 117, 160
Cac8I GCNNGC 2 cut(s) 57, 164
CviAII CATG 4 cut(s) 56, 69, 75, 96
CviJI RGCY 3 cut(s) 174, 237, 245
CviKI_1 RGCY 3 cut(s) 174, 237, 245
DdeI CTNAG 1 cut(s) 167
DraI TTTAAA 1 cut(s) 40
EcoRII CCWGG 1 cut(s) 148
FaeI CATG 4 cut(s) 59, 72, 78, 99
FaiI YATR 5 cut(s) 50, 57, 70, 76, 97
FaqI GGGAC 1 cut(s) 117
FatI CATG 4 cut(s) 55, 68, 74, 95
FauI CCCGC 1 cut(s) 171
FokI GGATG 3 cut(s) 92, 124, 167
GsaI CCCAGC 1 cut(s) 33
HaeIII GGCC 1 cut(s) 174
HapII CCGG 1 cut(s) 175
Hin1II CATG 4 cut(s) 59, 72, 78, 99
HpaII CCGG 1 cut(s) 175
Hpy166II GTNNAC 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 223
Hpy188III TCNNGA 2 cut(s) 134, 204
Hpy8I GTNNAC 1 cut(s) 143
HpyAV CCTTC 1 cut(s) 17
HpyCH4V TGCA 2 cut(s) 83, 185
HpyF3I CTNAG 1 cut(s) 167
Hsp92II CATG 4 cut(s) 59, 72, 78, 99
LpnPI CCDG 5 cut(s) 15, 135, 162, 188, 217
LweI GCATC 1 cut(s) 70
MnlI CCTC 1 cut(s) 164
MseI TTAA 1 cut(s) 39
MslI CAYNNNNRTG 1 cut(s) 73
MspI CCGG 1 cut(s) 175
MspR9I CCNGG 1 cut(s) 150
MvaI CCWGG 1 cut(s) 150
NlaIII CATG 4 cut(s) 59, 72, 78, 99
NspI RCATGY 2 cut(s) 59, 99
PaeI GCATGC 1 cut(s) 59
PasI CCCWGGG 1 cut(s) 149
PciI ACATGT 1 cut(s) 95
PscI ACATGT 1 cut(s) 95
Psp6I CCWGG 1 cut(s) 148
PspFI CCCAGC 1 cut(s) 29
PspGI CCWGG 1 cut(s) 148
RseI CAYNNNNRTG 1 cut(s) 73
SaqAI TTAA 1 cut(s) 39
ScrFI CCNGG 1 cut(s) 150
SfaNI GCATC 1 cut(s) 70
SmiMI CAYNNNNRTG 1 cut(s) 73
SphI GCATGC 1 cut(s) 59
SsiI CCGC 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 148
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TspDTI ATGAA 1 cut(s) 57
XceI RCATGY 2 cut(s) 59, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.