Rh1CG047400

Anaphase-promoting complex subunit 11 RING-H2 finger

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
8880376 .. 8884524
4149 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG047400.1

Sequence Viewer

Length: 183 bp
ATGAAAGTCCTGTGGCATGCTGTTGCTGCATGGACATGGGATGCTCAGGACGAAACATGTGGCATTTGTAGGATGGCATTTGATGGTTGTTGTCCTGATTGTAAGCTCCCTGGGGATGATTGTCCACTAAGTAGTATGCTTTTGTTGCTGAAGGCTTCAGAGCATTCTATGCTTCAAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.66

Weight (kDa)

4.64

Isoelectric Point (pI)

33.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-ANAPC11 PF12861 17 - 43 4.5e-15 Anaphase-promoting complex subunit 11 RING-H2 finger
zf-rbx1 PF12678 18 - 43 3.7e-06 RING-H2 zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015826)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 141, 170
AflIII ACRYGT 1 cut(s) 56
AgsI TTSAA 1 cut(s) 176
AjnI CCWGG 1 cut(s) 109
AluBI AGCT 1 cut(s) 106
AluI AGCT 1 cut(s) 106
ApeKI GCWGC 1 cut(s) 26
BbvI GCAGC 1 cut(s) 13
BccI CCATC 2 cut(s) 67, 77
BciT130I CCWGG 1 cut(s) 111
BisI GCNGC 1 cut(s) 27
BlsI GCNGC 1 cut(s) 28
Bme1390I CCNGG 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 111
BmsI GCATC 1 cut(s) 31
Bpu10I CCTNAGC 1 cut(s) 45
BsaJI CCNNGG 2 cut(s) 109, 110
BseBI CCWGG 1 cut(s) 111
BseDI CCNNGG 2 cut(s) 109, 110
BseGI GGATG 3 cut(s) 46, 78, 121
BseMII CTCAG 1 cut(s) 59
BseXI GCAGC 1 cut(s) 13
BsmI GAATGC 1 cut(s) 163
BspCNI CTCAG 1 cut(s) 58
BssECI CCNNGG 2 cut(s) 109, 110
Bst2UI CCWGG 1 cut(s) 111
BstAPI GCANNNNNTGC 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 18
BstDEI CTNAG 2 cut(s) 45, 128
BstF5I GGATG 3 cut(s) 46, 78, 121
BstMWI GCNNNNNNNGC 3 cut(s) 26, 145, 169
BstNI CCWGG 1 cut(s) 111
BstNSI RCATGY 2 cut(s) 20, 60
BstSCI CCNGG 1 cut(s) 109
BstV1I GCAGC 1 cut(s) 13
BtsCI GGATG 3 cut(s) 46, 78, 121
Cac8I GCNNGC 1 cut(s) 18
CviAII CATG 4 cut(s) 17, 30, 36, 57
CviJI RGCY 2 cut(s) 106, 155
CviKI_1 RGCY 2 cut(s) 106, 155
DdeI CTNAG 2 cut(s) 45, 128
Eco57I CTGAAG 2 cut(s) 141, 170
EcoRII CCWGG 1 cut(s) 109
FaeI CATG 4 cut(s) 20, 33, 39, 60
FaiI YATR 6 cut(s) 18, 31, 37, 58, 137, 170
FatI CATG 4 cut(s) 16, 29, 35, 56
Fnu4HI GCNGC 1 cut(s) 27
FokI GGATG 3 cut(s) 53, 85, 128
Fsp4HI GCNGC 1 cut(s) 27
GluI GCNGC 1 cut(s) 27
Hin1II CATG 4 cut(s) 20, 33, 39, 60
Hpy166II GTNNAC 1 cut(s) 125
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 2 cut(s) 47, 95
Hpy8I GTNNAC 1 cut(s) 125
HpyAV CCTTC 1 cut(s) 145
HpyCH4V TGCA 1 cut(s) 29
HpyF10VI GCNNNNNNNGC 3 cut(s) 26, 145, 169
HpyF3I CTNAG 2 cut(s) 45, 128
Hsp92II CATG 4 cut(s) 20, 33, 39, 60
LmnI GCTCC 1 cut(s) 111
LpnPI CCDG 5 cut(s) 23, 32, 96, 108, 123
Lsp1109I GCAGC 1 cut(s) 13
LweI GCATC 1 cut(s) 31
MslI CAYNNNNRTG 1 cut(s) 34
MspR9I CCNGG 1 cut(s) 111
Mva1269I GAATGC 1 cut(s) 163
MvaI CCWGG 1 cut(s) 111
MwoI GCNNNNNNNGC 3 cut(s) 26, 145, 169
NlaIII CATG 4 cut(s) 20, 33, 39, 60
NspI RCATGY 2 cut(s) 20, 60
PaeI GCATGC 1 cut(s) 20
PasI CCCWGGG 1 cut(s) 110
PciI ACATGT 1 cut(s) 56
PctI GAATGC 1 cut(s) 163
PkrI GCNGC 1 cut(s) 28
PscI ACATGT 1 cut(s) 56
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 34
SatI GCNGC 1 cut(s) 27
ScrFI CCNGG 1 cut(s) 111
SetI ASST 1 cut(s) 108
SfaNI GCATC 1 cut(s) 31
SgeI CNNG 9 cut(s) 22, 29, 42, 48, 59, 69, 107, 122, 123
SmiMI CAYNNNNRTG 1 cut(s) 34
SphI GCATGC 1 cut(s) 20
StyD4I CCNGG 1 cut(s) 109
TseI GCWGC 1 cut(s) 26
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 2 cut(s) 20, 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.