Rroxscaffold_4G00327730

Anaphase-promoting complex subunit

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
60606650 .. 60606862
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00327730.1

Sequence Viewer

Length: 213 bp
ATGTGCCCTTTTGTGAGATGTGATAAATTCATTTGCTTTGAGTTTAATTCTTATGTTTTCTTTTTTACCTGTAGGTGGCATGCTGTTGCTGCATGGACATGGGATGCTCAGGACGAAACATGTGGCATTTGTAGGATGGCATTTGATAGTTGTTGTCCTGATTGTAAGCTCCCTGGGGATGATTGTCCACTAAGTAAGTCACAGACATTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.11

Weight (kDa)

4.7

Isoelectric Point (pI)

45.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-ANAPC11 PF12861 38 - 64 2.1e-12 Anaphase-promoting complex subunit 11 RING-H2 finger
zf-rbx1 PF12678 39 - 66 6.1e-06 RING-H2 zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015826)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 211
AcsI RAATTY 1 cut(s) 26
AfiI CCNNNNNNNGG 1 cut(s) 75
AflIII ACRYGT 1 cut(s) 119
AjnI CCWGG 1 cut(s) 172
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
ApeKI GCWGC 1 cut(s) 89
ApoI RAATTY 1 cut(s) 26
BaeGI GKGCMC 1 cut(s) 8
BbvI GCAGC 1 cut(s) 76
BccI CCATC 1 cut(s) 130
BciT130I CCWGG 1 cut(s) 174
BfmI CTRYAG 1 cut(s) 70
BisI GCNGC 1 cut(s) 90
BlsI GCNGC 1 cut(s) 91
Bme1390I CCNGG 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 174
BmsI GCATC 1 cut(s) 94
Bpu10I CCTNAGC 1 cut(s) 108
BsaJI CCNNGG 2 cut(s) 172, 173
Bsc4I CCNNNNNNNGG 1 cut(s) 75
BseBI CCWGG 1 cut(s) 174
BseDI CCNNGG 2 cut(s) 172, 173
BseGI GGATG 3 cut(s) 109, 141, 184
BseLI CCNNNNNNNGG 1 cut(s) 75
BseMII CTCAG 1 cut(s) 122
BseSI GKGCMC 1 cut(s) 8
BseXI GCAGC 1 cut(s) 76
BslI CCNNNNNNNGG 1 cut(s) 75
Bsp1286I GDGCHC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 121
BssECI CCNNGG 2 cut(s) 172, 173
Bst2UI CCWGG 1 cut(s) 174
BstC8I GCNNGC 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 108, 191
BstF5I GGATG 3 cut(s) 109, 141, 184
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstNI CCWGG 1 cut(s) 174
BstNSI RCATGY 2 cut(s) 83, 123
BstSCI CCNGG 1 cut(s) 172
BstSFI CTRYAG 1 cut(s) 70
BstSLI GKGCMC 1 cut(s) 8
BstV1I GCAGC 1 cut(s) 76
BtsCI GGATG 3 cut(s) 109, 141, 184
Cac8I GCNNGC 1 cut(s) 81
CviAII CATG 4 cut(s) 80, 93, 99, 120
CviJI RGCY 1 cut(s) 169
CviKI_1 RGCY 1 cut(s) 169
DdeI CTNAG 2 cut(s) 108, 191
EcoRII CCWGG 1 cut(s) 172
FaeI CATG 4 cut(s) 83, 96, 102, 123
FaiI YATR 6 cut(s) 54, 81, 94, 100, 121, 211
FatI CATG 4 cut(s) 79, 92, 98, 119
Fnu4HI GCNGC 1 cut(s) 90
FokI GGATG 3 cut(s) 116, 148, 191
Fsp4HI GCNGC 1 cut(s) 90
GluI GCNGC 1 cut(s) 90
Hin1II CATG 4 cut(s) 83, 96, 102, 123
Hpy166II GTNNAC 1 cut(s) 188
Hpy188III TCNNGA 2 cut(s) 110, 158
Hpy8I GTNNAC 1 cut(s) 188
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
HpyF3I CTNAG 2 cut(s) 108, 191
Hsp92II CATG 4 cut(s) 83, 96, 102, 123
LmnI GCTCC 1 cut(s) 174
LpnPI CCDG 5 cut(s) 82, 95, 159, 171, 186
Lsp1109I GCAGC 1 cut(s) 76
LweI GCATC 1 cut(s) 94
MaeIII GTNAC 1 cut(s) 198
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 2 cut(s) 26, 46
MseI TTAA 1 cut(s) 45
MslI CAYNNNNRTG 1 cut(s) 97
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
MwoI GCNNNNNNNGC 1 cut(s) 89
NlaIII CATG 4 cut(s) 83, 96, 102, 123
NmuCI GTSAC 1 cut(s) 198
NspI RCATGY 2 cut(s) 83, 123
PaeI GCATGC 1 cut(s) 83
PasI CCCWGGG 1 cut(s) 173
PciI ACATGT 1 cut(s) 119
PkrI GCNGC 1 cut(s) 91
PscI ACATGT 1 cut(s) 119
PsiI TTATAA 1 cut(s) 211
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
RseI CAYNNNNRTG 1 cut(s) 97
SaqAI TTAA 1 cut(s) 45
SatI GCNGC 1 cut(s) 90
ScrFI CCNGG 1 cut(s) 174
SduI GDGCHC 1 cut(s) 8
SetI ASST 3 cut(s) 71, 77, 171
SfaNI GCATC 1 cut(s) 94
SfcI CTRYAG 1 cut(s) 70
SgeI CNNG 9 cut(s) 81, 92, 105, 111, 122, 132, 170, 185, 186
SmiMI CAYNNNNRTG 1 cut(s) 97
SphI GCATGC 1 cut(s) 83
Sse9I AATT 2 cut(s) 26, 46
StyD4I CCNGG 1 cut(s) 172
TasI AATT 2 cut(s) 26, 46
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TseFI GTSAC 1 cut(s) 198
TseI GCWGC 1 cut(s) 89
Tsp45I GTSAC 1 cut(s) 198
TspDTI ATGAA 1 cut(s) 19
XapI RAATTY 1 cut(s) 26
XceI RCATGY 2 cut(s) 83, 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.