MD06G1066300.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0018486
Physical Location & Seq
Reverse (-)
14099199 .. 14099609
411 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1066300.v1.1.491

Sequence Viewer

Length: 171 bp
ATGGAGGGTTTGGCGGGTCCGACGATCCGATTTCGCCGGCTCTGTCGGAGATGCTACCTGAGGAAGGCTTCGCTCTCAGAGAATGAAGGAGTGCAACCTTTAAAGGGAAGGGATATATTCAGACCAAAAAAGAAAAGGGAAGCGATACATCCATTCTTTTCCCTGCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.59

Weight (kDa)

10.91

Isoelectric Point (pI)

51.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 14
AclWI GGATC 1 cut(s) 19
AfiI CCNNNNNNNGG 2 cut(s) 64, 104
AlwI GGATC 1 cut(s) 19
AspS9I GGNCC 1 cut(s) 17
AvaII GGWCC 1 cut(s) 17
AxyI CCTNAGG 1 cut(s) 59
BfmI CTRYAG 1 cut(s) 167
Bme18I GGWCC 1 cut(s) 17
BmgT120I GGNCC 1 cut(s) 17
BmiI GGNNCC 1 cut(s) 18
BmsI GCATC 1 cut(s) 41
Bsc4I CCNNNNNNNGG 2 cut(s) 64, 104
Bse118I RCCGGY 1 cut(s) 36
Bse21I CCTNAGG 1 cut(s) 59
BseGI GGATG 1 cut(s) 148
BseLI CCNNNNNNNGG 2 cut(s) 64, 104
BseMII CTCAG 2 cut(s) 50, 90
BsiSI CCGG 1 cut(s) 37
BslI CCNNNNNNNGG 2 cut(s) 64, 104
Bsp143I GATC 1 cut(s) 24
BspACI CCGC 1 cut(s) 14
BspCNI CTCAG 2 cut(s) 51, 89
BspLI GGNNCC 1 cut(s) 18
BspPI GGATC 1 cut(s) 19
BsrFI RCCGGY 1 cut(s) 36
BssAI RCCGGY 1 cut(s) 36
BssMI GATC 1 cut(s) 24
BstC8I GCNNGC 1 cut(s) 38
BstDEI CTNAG 2 cut(s) 59, 76
BstENI CCTNNNNNAGG 1 cut(s) 62
BstF5I GGATG 1 cut(s) 148
BstKTI GATC 1 cut(s) 27
BstMBI GATC 1 cut(s) 24
BstSFI CTRYAG 1 cut(s) 167
Bsu36I CCTNAGG 1 cut(s) 59
BtsCI GGATG 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 38
Cfr10I RCCGGY 1 cut(s) 36
Cfr13I GGNCC 1 cut(s) 17
CviJI RGCY 2 cut(s) 40, 68
CviKI_1 RGCY 2 cut(s) 40, 68
DdeI CTNAG 2 cut(s) 59, 76
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
DraI TTTAAA 1 cut(s) 102
Eco47I GGWCC 1 cut(s) 17
Eco81I CCTNAGG 1 cut(s) 59
EcoNI CCTNNNNNAGG 1 cut(s) 62
FaiI YATR 2 cut(s) 116, 169
FauI CCCGC 1 cut(s) 7
FokI GGATG 1 cut(s) 135
HapII CCGG 1 cut(s) 37
HpaII CCGG 1 cut(s) 37
Hpy188I TCNGA 5 cut(s) 21, 29, 48, 79, 122
Hpy99I CGWCG 1 cut(s) 25
HpyAV CCTTC 3 cut(s) 58, 80, 102
HpyCH4V TGCA 1 cut(s) 94
HpyF3I CTNAG 2 cut(s) 59, 76
KroI GCCGGC 1 cut(s) 36
KroNI GCCGGC 1 cut(s) 38
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 2 cut(s) 50, 71
LweI GCATC 1 cut(s) 41
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MmeI TCCRAC 2 cut(s) 26, 44
MnlI CCTC 1 cut(s) 54
MroNI GCCGGC 1 cut(s) 36
MseI TTAA 1 cut(s) 101
MspI CCGG 1 cut(s) 37
NaeI GCCGGC 1 cut(s) 38
NdeII GATC 1 cut(s) 24
NgoMIV GCCGGC 1 cut(s) 36
NlaIV GGNNCC 1 cut(s) 18
PdiI GCCGGC 1 cut(s) 38
PspN4I GGNNCC 1 cut(s) 18
PspPI GGNCC 1 cut(s) 17
SaqAI TTAA 1 cut(s) 101
Sau3AI GATC 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 17
SetI ASST 2 cut(s) 60, 100
SfaNI GCATC 1 cut(s) 41
SfcI CTRYAG 1 cut(s) 167
SgeI CNNG 3 cut(s) 27, 49, 70
SinI GGWCC 1 cut(s) 17
SsiI CCGC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 99
VpaK11BI GGWCC 1 cut(s) 17
XagI CCTNNNNNAGG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.