Rmu_sc0002990.1_g000001

Permease family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002990.1
OG0018486
Physical Location & Seq
Reverse (-)
1 .. 425
425 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002990.1_g000001.1.cds

Sequence Viewer

Length: 192 bp
atggcagctccagctaaaccagaagagataagccatccaccaatggaccagcttcagggattagagtactgcattgactcaaacccatcttggggggaggcaattgctttgggttttcagcactacattttggccttgggaactgctgttatgatcccttcatttcttgtacctttgatgggtggcactgat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Xan_ur_permease

Protein Analysis

64

Amino Acids

6.84

Weight (kDa)

4.3

Isoelectric Point (pI)

51.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 148
AcuI CTGAAG 1 cut(s) 38
AfaI GTAC 2 cut(s) 68, 171
AfiI CCNNNNNNNGG 4 cut(s) 55, 91, 92, 179
AluBI AGCT 3 cut(s) 8, 14, 52
AluI AGCT 3 cut(s) 8, 14, 52
AlwI GGATC 1 cut(s) 148
AoxI GGCC 1 cut(s) 132
ApeKI GCWGC 1 cut(s) 5
AspS9I GGNCC 1 cut(s) 46
AvaII GGWCC 1 cut(s) 46
BbvI GCAGC 1 cut(s) 17
BccI CCATC 3 cut(s) 42, 94, 172
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
BmcAI AGTACT 1 cut(s) 68
Bme18I GGWCC 1 cut(s) 46
BmgT120I GGNCC 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 135
Bsc4I CCNNNNNNNGG 4 cut(s) 55, 91, 92, 179
BseDI CCNNGG 1 cut(s) 135
BseGI GGATG 1 cut(s) 34
BseLI CCNNNNNNNGG 4 cut(s) 55, 91, 92, 179
BseXI GCAGC 1 cut(s) 17
BshFI GGCC 1 cut(s) 134
BslI CCNNNNNNNGG 4 cut(s) 55, 91, 92, 179
BsnI GGCC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 153
BspANI GGCC 1 cut(s) 134
BspPI GGATC 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 1 cut(s) 153
BssT1I CCWWGG 1 cut(s) 135
Bst6I CTCTTC 1 cut(s) 18
BstF5I GGATG 1 cut(s) 34
BstKTI GATC 1 cut(s) 156
BstMBI GATC 1 cut(s) 153
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstV1I GCAGC 1 cut(s) 17
BsuRI GGCC 1 cut(s) 134
BtsCI GGATG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 186
Cfr13I GGNCC 1 cut(s) 46
Csp6I GTAC 2 cut(s) 67, 170
CviJI RGCY 5 cut(s) 8, 14, 33, 52, 134
CviKI_1 RGCY 5 cut(s) 8, 14, 33, 52, 134
CviQI GTAC 2 cut(s) 67, 170
DpnI GATC 1 cut(s) 155
DpnII GATC 1 cut(s) 153
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
Eco130I CCWWGG 1 cut(s) 135
Eco47I GGWCC 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 38
EcoT14I CCWWGG 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 135
FaiI YATR 1 cut(s) 152
Fnu4HI GCNGC 1 cut(s) 6
FokI GGATG 1 cut(s) 21
Fsp4HI GCNGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 134
HinfI GANTC 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 168
HpyCH4V TGCA 1 cut(s) 72
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
Kzo9I GATC 1 cut(s) 153
LmnI GCTCC 1 cut(s) 13
LpnPI CCDG 4 cut(s) 24, 33, 41, 62
Lsp1109I GCAGC 1 cut(s) 17
MalI GATC 1 cut(s) 155
MboI GATC 1 cut(s) 153
MboII GAAGA 1 cut(s) 35
MfeI CAATTG 1 cut(s) 102
MluCI AATT 1 cut(s) 102
MlyI GAGTC 1 cut(s) 71
MnlI CCTC 1 cut(s) 91
MunI CAATTG 1 cut(s) 102
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 1 cut(s) 153
PkrI GCNGC 1 cut(s) 7
PleI GAGTC 1 cut(s) 71
PpsI GAGTC 1 cut(s) 71
PspPI GGNCC 1 cut(s) 46
RsaI GTAC 2 cut(s) 68, 171
RsaNI GTAC 2 cut(s) 67, 170
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 1 cut(s) 153
Sau96I GGNCC 1 cut(s) 46
ScaI AGTACT 1 cut(s) 68
SchI GAGTC 1 cut(s) 71
SetI ASST 4 cut(s) 10, 16, 54, 175
SgeI CNNG 7 cut(s) 23, 32, 61, 68, 102, 148, 179
SinI GGWCC 1 cut(s) 46
Sse9I AATT 1 cut(s) 102
StyI CCWWGG 1 cut(s) 135
TasI AATT 1 cut(s) 102
TatI WGTACW 1 cut(s) 66
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 46
ZrmI AGTACT 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.