MD06G1122200.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0016554
Physical Location & Seq
Reverse (-)
26347905 .. 26348875
971 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1122200.v1.1.491

Sequence Viewer

Length: 207 bp
ATGAAGGGGTCCGGCAGTCTGGTCGCGTCGGTGGTCGCCGTTTCGACGGTGGCTCTGACGACGTCGTCACCGTCCAACCAGGGTTCTTCTTCCCCGGCGACGAAGAACGGCGGACAAAATTCGAATTCGGCGTCGGATAAGGATAAATTCGAGCCGAGATTCGACGGGTTGAGGTTCATTGAGACGCTGGTGACGGCGCACAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

6.98

Weight (kDa)

9.52

Isoelectric Point (pI)

42.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016554)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G42110
fragaria_vesca FvH4_5g10570 FvH4_5g10570 FvH4_5g10570
malus_domestica MD06G1122200.v1.1 MD14G1138600.v1.1
prunus_persica Prupe.5G132900_v2.0.a1 Prupe.5G132900_v2.0.a1
pyrus_communis pycom14g11390
rosa_chinensis RchiOBHm_Chr7g0187581
rosa_roxburghii Rroxscaffold_3G00267290
rosa_rugosa Rorug06G0482800
rosa_samantha Rh7AG087700 Rh7DG089900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 64
AatII GACGTC 1 cut(s) 65
AccII CGCG 1 cut(s) 26
AciI CCGC 1 cut(s) 111
AcsI RAATTY 3 cut(s) 118, 124, 146
AcyI GRCGYC 2 cut(s) 62, 131
AjnI CCWGG 1 cut(s) 78
Alw26I GTCTC 1 cut(s) 176
ApoI RAATTY 3 cut(s) 118, 124, 146
ArsI GACNNNNNNTTYG 2 cut(s) 116, 148
AspLEI GCGC 1 cut(s) 199
AspS9I GGNCC 1 cut(s) 9
AsuC2I CCSGG 1 cut(s) 95
AsuHPI GGTGA 2 cut(s) 60, 202
AsuII TTCGAA 1 cut(s) 122
AvaII GGWCC 1 cut(s) 9
BceAI ACGGC 2 cut(s) 23, 124
BcgI CGANNNNNNTGC 2 cut(s) 4, 38
BciT130I CCWGG 1 cut(s) 80
BcnI CCSGG 1 cut(s) 95
BcoDI GTCTC 1 cut(s) 176
Bme1390I CCNGG 2 cut(s) 80, 95
Bme18I GGWCC 1 cut(s) 9
BmgT120I GGNCC 1 cut(s) 9
BmiI GGNNCC 1 cut(s) 10
BmrFI CCNGG 2 cut(s) 80, 95
Bpu14I TTCGAA 1 cut(s) 122
BpuMI CCSGG 1 cut(s) 95
BsaHI GRCGYC 2 cut(s) 62, 131
BsaJI CCNNGG 2 cut(s) 79, 93
BseBI CCWGG 1 cut(s) 80
BseDI CCNNGG 2 cut(s) 79, 93
Bsh1236I CGCG 1 cut(s) 26
BsiSI CCGG 2 cut(s) 12, 95
BsmAI GTCTC 1 cut(s) 176
BsmBI CGTCTC 1 cut(s) 176
Bsp119I TTCGAA 1 cut(s) 122
BspACI CCGC 1 cut(s) 111
BspFNI CGCG 1 cut(s) 26
BspLI GGNNCC 1 cut(s) 10
BspT104I TTCGAA 1 cut(s) 122
BssECI CCNNGG 2 cut(s) 79, 93
BssNI GRCGYC 2 cut(s) 62, 131
Bst2UI CCWGG 1 cut(s) 80
Bst4CI ACNGT 2 cut(s) 49, 72
BstACI GRCGYC 2 cut(s) 62, 131
BstBI TTCGAA 1 cut(s) 122
BstFNI CGCG 1 cut(s) 26
BstHHI GCGC 1 cut(s) 199
BstMAI GTCTC 1 cut(s) 176
BstNI CCWGG 1 cut(s) 80
BstSCI CCNGG 2 cut(s) 78, 93
BstUI CGCG 1 cut(s) 26
CfoI GCGC 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 9
CseI GACGC 3 cut(s) 15, 120, 193
CviJI RGCY 2 cut(s) 53, 154
CviKI_1 RGCY 2 cut(s) 53, 154
DrdI GACNNNNNNGTC 1 cut(s) 64
DseDI GACNNNNNNGTC 1 cut(s) 64
EciI GGCGGA 1 cut(s) 126
Eco47I GGWCC 1 cut(s) 9
EcoRI GAATTC 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 78
Esp3I CGTCTC 1 cut(s) 176
GlaI GCGC 1 cut(s) 198
HapII CCGG 2 cut(s) 12, 95
HgaI GACGC 3 cut(s) 15, 120, 193
HhaI GCGC 1 cut(s) 199
Hin1I GRCGYC 2 cut(s) 62, 131
Hin6I GCGC 1 cut(s) 197
HinP1I GCGC 1 cut(s) 197
HinfI GANTC 1 cut(s) 159
HpaII CCGG 2 cut(s) 12, 95
HphI GGTGA 2 cut(s) 60, 202
Hpy188I TCNGA 2 cut(s) 57, 136
Hpy99I CGWCG 7 cut(s) 31, 49, 64, 67, 103, 136, 167
HpyCH4III ACNGT 2 cut(s) 49, 72
HpyCH4IV ACGT 1 cut(s) 62
HpySE526I ACGT 1 cut(s) 62
Hsp92I GRCGYC 2 cut(s) 62, 131
HspAI GCGC 1 cut(s) 197
LpnPI CCDG 6 cut(s) 5, 25, 65, 92, 108, 173
MaeII ACGT 1 cut(s) 62
MaeIII GTNAC 2 cut(s) 66, 190
MboII GAAGA 3 cut(s) 78, 81, 115
MluCI AATT 3 cut(s) 118, 124, 146
MmeI TCCRAC 2 cut(s) 99, 114
MnlI CCTC 1 cut(s) 165
MspI CCGG 2 cut(s) 12, 95
MspR9I CCNGG 2 cut(s) 80, 95
MvaI CCWGG 1 cut(s) 80
MvnI CGCG 1 cut(s) 26
NciI CCSGG 1 cut(s) 95
NlaIV GGNNCC 1 cut(s) 10
NmeAIII GCCGAG 1 cut(s) 180
NmuCI GTSAC 2 cut(s) 66, 190
NspV TTCGAA 1 cut(s) 122
PcsI WCGNNNNNNNCGW 2 cut(s) 68, 128
PfeI GAWTC 1 cut(s) 159
PflFI GACNNNGTC 2 cut(s) 61, 64
Psp6I CCWGG 1 cut(s) 78
PspGI CCWGG 1 cut(s) 78
PspN4I GGNNCC 1 cut(s) 10
PspPI GGNCC 1 cut(s) 9
PsyI GACNNNGTC 2 cut(s) 61, 64
Sau96I GGNCC 1 cut(s) 9
ScrFI CCNGG 2 cut(s) 80, 95
SetI ASST 2 cut(s) 65, 176
SfuI TTCGAA 1 cut(s) 122
SinI GGWCC 1 cut(s) 9
Sse9I AATT 3 cut(s) 118, 124, 146
SsiI CCGC 1 cut(s) 111
StyD4I CCNGG 2 cut(s) 78, 93
TaaI ACNGT 2 cut(s) 49, 72
TaiI ACGT 1 cut(s) 65
TaqI TCGA 4 cut(s) 44, 122, 150, 162
TasI AATT 3 cut(s) 118, 124, 146
TfiI GAWTC 1 cut(s) 159
TseFI GTSAC 2 cut(s) 66, 190
Tsp45I GTSAC 2 cut(s) 66, 190
TspDTI ATGAA 2 cut(s) 17, 166
Tth111I GACNNNGTC 2 cut(s) 61, 64
VpaK11BI GGWCC 1 cut(s) 9
XapI RAATTY 3 cut(s) 118, 124, 146
ZraI GACGTC 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.