MD07G1130600.v1.1

Late embryogenesis abundant protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0014279
Physical Location & Seq
Reverse (-)
18659507 .. 18659800
294 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1130600.v1.1.491

Sequence Viewer

Length: 294 bp
ATGGTGGTGGGAGAGGCTCATGGGCCACCCGGCCAGGCTAAGGCTGGATGGACTATGAGGATGAATATCACGGTTGTTATCATCACAAATCGGCTCACGTCGACCCCCAACGTTAGGGCAGATATGGGTTCGGGATGGTTGACCATGAGTAGCTATTCTAGAATTCCAGGAAGGGTGAAGATGTTGAATATTATCAAGAAACATGTGGTCGTGAAAATGAATTGTACTATCGCTATTAATATTTCCAGTCAGGCAATTCAAGAACAAAAATGCAAGAGGAAGGTTAATCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LEA_2

Protein Analysis

98

Amino Acids

10.71

Weight (kDa)

10.77

Isoelectric Point (pI)

47.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014279)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G46150
fragaria_vesca FvH4_7g15490
malus_domestica MD01G1072100.v1.1 MD07G1130600.v1.1
prunus_persica Prupe.2G178500_v2.0.a1
pyrus_communis pycom01g10140
rosa_chinensis RchiOBHm_Chr1g0357811
rosa_laevigata RLG00000027994
rosa_multiflora Rmu_co8384079.1_g000001 Rmu_sc0011109.1_g000008
rosa_roxburghii Rroxscaffold_4G00298480
rosa_rugosa Rorug01G0258800
rosa_samantha Rh1AG272700 Rh1BG240000 Rh1CG256600 Rh1DG268300
rosa_wichuraiana Rw1G024340

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 101
AclI AACGTT 1 cut(s) 111
AcoI YGGCCR 1 cut(s) 31
AcsI RAATTY 1 cut(s) 162
AfaI GTAC 1 cut(s) 226
AfiI CCNNNNNNNGG 2 cut(s) 40, 114
AflIII ACRYGT 1 cut(s) 202
AgsI TTSAA 2 cut(s) 187, 260
AjiI CACGTC 1 cut(s) 99
AjnI CCWGG 2 cut(s) 33, 166
AluBI AGCT 1 cut(s) 153
AluI AGCT 1 cut(s) 153
AoxI GGCC 2 cut(s) 23, 31
ApoI RAATTY 1 cut(s) 162
AseI ATTAAT 1 cut(s) 237
AspS9I GGNCC 1 cut(s) 23
AsuC2I CCSGG 1 cut(s) 30
AsuHPI GGTGA 1 cut(s) 187
BccI CCATC 2 cut(s) 42, 129
BciT130I CCWGG 2 cut(s) 35, 168
BcnI CCSGG 1 cut(s) 30
BfaI CTAG 2 cut(s) 159, 292
Bme1390I CCNGG 3 cut(s) 30, 35, 168
BmgBI CACGTC 1 cut(s) 99
BmgT120I GGNCC 1 cut(s) 23
BmrFI CCNGG 3 cut(s) 30, 35, 168
Bpu10I CCTNAGC 1 cut(s) 39
BpuMI CCSGG 1 cut(s) 30
BsaBI GATNNNNATC 1 cut(s) 65
Bsc4I CCNNNNNNNGG 2 cut(s) 40, 114
Bse1I ACTGG 1 cut(s) 246
Bse8I GATNNNNATC 1 cut(s) 65
BseBI CCWGG 2 cut(s) 35, 168
BseGI GGATG 3 cut(s) 53, 66, 140
BseJI GATNNNNATC 1 cut(s) 65
BseLI CCNNNNNNNGG 2 cut(s) 40, 114
BseNI ACTGG 1 cut(s) 246
BshFI GGCC 2 cut(s) 25, 33
BsiSI CCGG 1 cut(s) 30
BslI CCNNNNNNNGG 2 cut(s) 40, 114
BsnI GGCC 2 cut(s) 25, 33
BspANI GGCC 2 cut(s) 25, 33
BsrI ACTGG 1 cut(s) 246
Bst2UI CCWGG 2 cut(s) 35, 168
Bst4CI ACNGT 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 39
BstF5I GGATG 3 cut(s) 53, 66, 140
BstNI CCWGG 2 cut(s) 35, 168
BstNSI RCATGY 1 cut(s) 206
BstSCI CCNGG 3 cut(s) 28, 33, 166
BsuRI GGCC 2 cut(s) 25, 33
BtrI CACGTC 1 cut(s) 99
BtsCI GGATG 3 cut(s) 53, 66, 140
Cfr13I GGNCC 1 cut(s) 23
Csp6I GTAC 1 cut(s) 225
CviAII CATG 3 cut(s) 20, 145, 203
CviJI RGCY 7 cut(s) 17, 25, 33, 38, 44, 94, 153
CviKI_1 RGCY 7 cut(s) 17, 25, 33, 38, 44, 94, 153
CviQI GTAC 1 cut(s) 225
DdeI CTNAG 1 cut(s) 39
EaeI YGGCCR 1 cut(s) 31
EcoRI GAATTC 1 cut(s) 162
EcoRII CCWGG 2 cut(s) 33, 166
FaeI CATG 3 cut(s) 23, 148, 206
FaiI YATR 5 cut(s) 21, 56, 125, 146, 204
FatI CATG 3 cut(s) 19, 144, 202
FblI GTMKAC 1 cut(s) 101
FokI GGATG 3 cut(s) 60, 73, 147
FspBI CTAG 2 cut(s) 159, 292
HaeIII GGCC 2 cut(s) 25, 33
HapII CCGG 1 cut(s) 30
Hin1II CATG 3 cut(s) 23, 148, 206
HincII GTYRAC 2 cut(s) 102, 141
HindII GTYRAC 2 cut(s) 102, 141
HpaII CCGG 1 cut(s) 30
HphI GGTGA 1 cut(s) 187
Hpy166II GTNNAC 2 cut(s) 102, 141
Hpy188III TCNNGA 5 cut(s) 132, 159, 196, 211, 260
Hpy8I GTNNAC 2 cut(s) 102, 141
Hpy99I CGWCG 1 cut(s) 103
HpyAV CCTTC 2 cut(s) 165, 274
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4IV ACGT 2 cut(s) 98, 111
HpyCH4V TGCA 1 cut(s) 273
HpyF3I CTNAG 1 cut(s) 39
HpySE526I ACGT 2 cut(s) 98, 111
Hsp92II CATG 3 cut(s) 23, 148, 206
LpnPI CCDG 8 cut(s) 20, 30, 43, 47, 153, 180, 236, 259
MaeI CTAG 2 cut(s) 159, 292
MaeII ACGT 2 cut(s) 98, 111
MboII GAAGA 1 cut(s) 190
MluCI AATT 3 cut(s) 162, 220, 255
MnlI CCTC 3 cut(s) 7, 51, 270
MseI TTAA 2 cut(s) 237, 285
MspI CCGG 1 cut(s) 30
MspR9I CCNGG 3 cut(s) 30, 35, 168
MvaI CCWGG 2 cut(s) 35, 168
NciI CCSGG 1 cut(s) 30
NlaIII CATG 3 cut(s) 23, 148, 206
NspI RCATGY 1 cut(s) 206
PciI ACATGT 1 cut(s) 202
PfoI TCCNGGA 1 cut(s) 166
PscI ACATGT 1 cut(s) 202
PshBI ATTAAT 1 cut(s) 237
Psp1406I AACGTT 1 cut(s) 111
Psp6I CCWGG 2 cut(s) 33, 166
PspGI CCWGG 2 cut(s) 33, 166
PspPI GGNCC 1 cut(s) 23
RsaI GTAC 1 cut(s) 226
RsaNI GTAC 1 cut(s) 225
SalI GTCGAC 1 cut(s) 100
SaqAI TTAA 2 cut(s) 237, 285
Sau96I GGNCC 1 cut(s) 23
ScrFI CCNGG 3 cut(s) 30, 35, 168
SetI ASST 4 cut(s) 101, 114, 155, 285
Sse9I AATT 3 cut(s) 162, 220, 255
SspI AATATT 2 cut(s) 190, 241
SspMI CTAG 2 cut(s) 159, 292
StyD4I CCNGG 3 cut(s) 28, 33, 166
TaaI ACNGT 1 cut(s) 73
TaiI ACGT 2 cut(s) 101, 114
TaqI TCGA 1 cut(s) 101
TasI AATT 3 cut(s) 162, 220, 255
TatI WGTACW 1 cut(s) 224
Tru1I TTAA 2 cut(s) 237, 285
Tru9I TTAA 2 cut(s) 237, 285
TspDTI ATGAA 2 cut(s) 77, 233
VspI ATTAAT 1 cut(s) 237
XapI RAATTY 1 cut(s) 162
XbaI TCTAGA 1 cut(s) 158
XceI RCATGY 1 cut(s) 206
XcmI CCANNNNNNNNNTGG 1 cut(s) 41
XmiI GTMKAC 1 cut(s) 101
XspI CTAG 2 cut(s) 159, 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.