MD07G1217100.v1.1
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0006953
Physical Location & Seq
Reverse (-)
29493979 .. 29495697
1719 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1217100.v1.1.491

Sequence Viewer

Length: 276 bp
ATGAAGAAAAGGAGAAGACGACGAGGACCTAAGGAAGTTAAGAATGAAGAAGTTGATCCGTCTAAACTTAGCAAGGTACTTCCTAATAGGTTTCCTGCATCAGCATATCCCAAAGTGATGGAGGCGGTTGAGTCTTTACCTGAGGCAAATCCCTTGGGCGAATTGTGGTGGTTTGCCAAAGGACTATTTACATCTGATGAGAAGAGGGAGCGATTCTGTGAGTTGGAAGATGATCGGGCCAAGCTTGAATGGCTCCATTGCGAAATGGCCGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

92

Amino Acids

10.76

Weight (kDa)

7.76

Isoelectric Point (pI)

58.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 125
AclWI GGATC 1 cut(s) 50
AcoI YGGCCR 1 cut(s) 267
AfaI GTAC 1 cut(s) 78
AgsI TTSAA 1 cut(s) 248
AluBI AGCT 1 cut(s) 244
AluI AGCT 1 cut(s) 244
AlwI GGATC 1 cut(s) 50
AoxI GGCC 2 cut(s) 237, 267
AspS9I GGNCC 2 cut(s) 26, 237
AvaII GGWCC 1 cut(s) 26
AxyI CCTNAGG 2 cut(s) 30, 141
BbsI GAAGAC 1 cut(s) 22
BccI CCATC 1 cut(s) 112
Bme18I GGWCC 1 cut(s) 26
BmgT120I GGNCC 2 cut(s) 26, 237
BmiI GGNNCC 1 cut(s) 254
BmsI GCATC 1 cut(s) 107
BpiI GAAGAC 1 cut(s) 22
BsaJI CCNNGG 1 cut(s) 153
Bse21I CCTNAGG 2 cut(s) 30, 141
Bse3DI GCAATG 1 cut(s) 256
BseDI CCNNGG 1 cut(s) 153
BseMI GCAATG 1 cut(s) 256
BseMII CTCAG 1 cut(s) 132
BshFI GGCC 2 cut(s) 239, 269
BsnI GGCC 2 cut(s) 239, 269
Bsp143I GATC 2 cut(s) 55, 232
BspACI CCGC 1 cut(s) 125
BspANI GGCC 2 cut(s) 239, 269
BspCNI CTCAG 1 cut(s) 133
BspLI GGNNCC 1 cut(s) 254
BspPI GGATC 1 cut(s) 50
BsrDI GCAATG 1 cut(s) 256
BssECI CCNNGG 1 cut(s) 153
BssMI GATC 2 cut(s) 55, 232
BssT1I CCWWGG 1 cut(s) 153
Bst6I CTCTTC 1 cut(s) 197
BstDEI CTNAG 3 cut(s) 30, 68, 141
BstKTI GATC 2 cut(s) 58, 235
BstMBI GATC 2 cut(s) 55, 232
BstMWI GCNNNNNNNGC 1 cut(s) 250
BstV2I GAAGAC 1 cut(s) 22
BstXI CCANNNNNNTGG 1 cut(s) 118
Bsu36I CCTNAGG 2 cut(s) 30, 141
BsuRI GGCC 2 cut(s) 239, 269
Cfr13I GGNCC 2 cut(s) 26, 237
Csp6I GTAC 1 cut(s) 77
CviJI RGCY 4 cut(s) 239, 244, 253, 269
CviKI_1 RGCY 4 cut(s) 239, 244, 253, 269
CviQI GTAC 1 cut(s) 77
DdeI CTNAG 3 cut(s) 30, 68, 141
DpnI GATC 2 cut(s) 57, 234
DpnII GATC 2 cut(s) 55, 232
EaeI YGGCCR 1 cut(s) 267
Eam1104I CTCTTC 1 cut(s) 197
EarI CTCTTC 1 cut(s) 197
Eco130I CCWWGG 1 cut(s) 153
Eco47I GGWCC 1 cut(s) 26
Eco81I CCTNAGG 2 cut(s) 30, 141
EcoO109I RGGNCCY 1 cut(s) 26
EcoT14I CCWWGG 1 cut(s) 153
ErhI CCWWGG 1 cut(s) 153
FaiI YATR 1 cut(s) 106
HaeIII GGCC 2 cut(s) 239, 269
HindIII AAGCTT 1 cut(s) 242
HinfI GANTC 2 cut(s) 131, 213
Hpy188I TCNGA 1 cut(s) 196
Hpy99I CGWCG 1 cut(s) 24
HpyCH4V TGCA 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 250
HpyF3I CTNAG 3 cut(s) 30, 68, 141
Kzo9I GATC 2 cut(s) 55, 232
LmnI GCTCC 2 cut(s) 208, 258
LpnPI CCDG 2 cut(s) 108, 153
LweI GCATC 1 cut(s) 107
MalI GATC 2 cut(s) 57, 234
MboI GATC 2 cut(s) 55, 232
MboII GAAGA 5 cut(s) 16, 27, 59, 214, 239
MluCI AATT 1 cut(s) 161
MlyI GAGTC 1 cut(s) 140
MmeI TCCRAC 1 cut(s) 204
MnlI CCTC 4 cut(s) 17, 115, 136, 198
MseI TTAA 1 cut(s) 39
MwoI GCNNNNNNNGC 1 cut(s) 250
NdeII GATC 2 cut(s) 55, 232
NlaIV GGNNCC 1 cut(s) 254
PfeI GAWTC 1 cut(s) 213
PleI GAGTC 1 cut(s) 139
PpsI GAGTC 1 cut(s) 139
PpuMI RGGWCCY 1 cut(s) 26
Psp5II RGGWCCY 1 cut(s) 26
PspN4I GGNNCC 1 cut(s) 254
PspPI GGNCC 2 cut(s) 26, 237
PspPPI RGGWCCY 1 cut(s) 26
RsaI GTAC 1 cut(s) 78
RsaNI GTAC 1 cut(s) 77
SaqAI TTAA 1 cut(s) 39
Sau3AI GATC 2 cut(s) 55, 232
Sau96I GGNCC 2 cut(s) 26, 237
SchI GAGTC 1 cut(s) 140
SetI ASST 5 cut(s) 31, 78, 92, 142, 246
SfaNI GCATC 1 cut(s) 107
SgeI CNNG 8 cut(s) 35, 85, 107, 152, 166, 248, 253, 257
SinI GGWCC 1 cut(s) 26
Sse9I AATT 1 cut(s) 161
SsiI CCGC 1 cut(s) 125
StyI CCWWGG 1 cut(s) 153
TasI AATT 1 cut(s) 161
TfiI GAWTC 1 cut(s) 213
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TspDTI ATGAA 2 cut(s) 17, 60
TspGWI ACGGA 1 cut(s) 48
VpaK11BI GGWCC 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.