MD07G1270400.v1.1

isoform X1

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
33744307 .. 33744942
636 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1270400.v1.1.491

Sequence Viewer

Length: 345 bp
ATGTCACTTAATTGTGTGATATCGCCGATATTATCGATTTTTTCTTCTTTGGTCCTGACCATGACTGATGACAAAACAAAGCAGAAAGCCATTGAAGCTGCCGCTGATATTTTTGGGATTGATTCAATCGCGGCAGATATAAAGGACCAGAAGCTGACAGTTGTAGGACTGATGGATCCAGTGGCTGTAGTGAAGAAGTTGAAGAAGGTCGGGAAAGTAGACATAGTATCTGTCGGACCAGCCAAGGAAGAGAAGAAAGAAGAGAAAAAAGAAGAAAAGAAAGAGGAGAAGAAAGAGGAAAAGAAGGAGGAGAAAAAGGAAGAAAAGAAGGAGGACAAAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

12.74

Weight (kDa)

8.48

Isoelectric Point (pI)

39.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014198)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 219
AccII CGCG 1 cut(s) 131
AciI CCGC 2 cut(s) 102, 131
AclWI GGATC 2 cut(s) 170, 183
AgsI TTSAA 3 cut(s) 95, 126, 202
AluBI AGCT 2 cut(s) 98, 154
AluI AGCT 2 cut(s) 98, 154
AlwI GGATC 2 cut(s) 170, 183
AlwNI CAGNNNCTG 2 cut(s) 154, 185
ApeKI GCWGC 1 cut(s) 98
AspS9I GGNCC 3 cut(s) 52, 145, 236
AvaII GGWCC 3 cut(s) 52, 145, 236
BamHI GGATCC 1 cut(s) 175
BbvI GCAGC 1 cut(s) 85
BccI CCATC 1 cut(s) 166
BfmI CTRYAG 1 cut(s) 186
BisI GCNGC 3 cut(s) 99, 102, 132
BlsI GCNGC 3 cut(s) 100, 103, 133
Bme18I GGWCC 3 cut(s) 52, 145, 236
BmgT120I GGNCC 3 cut(s) 52, 145, 236
BmiI GGNNCC 1 cut(s) 177
Bsa29I ATCGAT 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 243
Bse1I ACTGG 1 cut(s) 179
BseCI ATCGAT 1 cut(s) 35
BseDI CCNNGG 1 cut(s) 243
BseNI ACTGG 1 cut(s) 179
BseRI GAGGAG 2 cut(s) 299, 323
BseXI GCAGC 1 cut(s) 85
Bsh1236I CGCG 1 cut(s) 131
BshVI ATCGAT 1 cut(s) 35
Bsp143I GATC 1 cut(s) 175
BspACI CCGC 2 cut(s) 102, 131
BspDI ATCGAT 1 cut(s) 35
BspFNI CGCG 1 cut(s) 131
BspLI GGNNCC 1 cut(s) 177
BspPI GGATC 2 cut(s) 170, 183
BsrI ACTGG 1 cut(s) 179
BssECI CCNNGG 1 cut(s) 243
BssMI GATC 1 cut(s) 175
BssT1I CCWWGG 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 160
Bst6I CTCTTC 2 cut(s) 243, 255
BstFNI CGCG 1 cut(s) 131
BstKTI GATC 1 cut(s) 178
BstMBI GATC 1 cut(s) 175
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstSFI CTRYAG 1 cut(s) 186
BstUI CGCG 1 cut(s) 131
BstV1I GCAGC 1 cut(s) 85
BstX2I RGATCY 1 cut(s) 175
BstYI RGATCY 1 cut(s) 175
Bsu15I ATCGAT 1 cut(s) 35
BsuTUI ATCGAT 1 cut(s) 35
BtsIMutI CAGTG 1 cut(s) 186
CaiI CAGNNNCTG 2 cut(s) 154, 185
Cfr13I GGNCC 3 cut(s) 52, 145, 236
ClaI ATCGAT 1 cut(s) 35
CviAII CATG 1 cut(s) 61
CviJI RGCY 5 cut(s) 89, 98, 154, 185, 242
CviKI_1 RGCY 5 cut(s) 89, 98, 154, 185, 242
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
Eam1104I CTCTTC 2 cut(s) 243, 255
EarI CTCTTC 2 cut(s) 243, 255
Eco130I CCWWGG 1 cut(s) 243
Eco32I GATATC 1 cut(s) 21
Eco47I GGWCC 3 cut(s) 52, 145, 236
EcoRV GATATC 1 cut(s) 21
EcoT14I CCWWGG 1 cut(s) 243
ErhI CCWWGG 1 cut(s) 243
FaeI CATG 1 cut(s) 64
FaiI YATR 3 cut(s) 62, 140, 224
FatI CATG 1 cut(s) 60
FblI GTMKAC 1 cut(s) 219
Fnu4HI GCNGC 3 cut(s) 99, 102, 132
Fsp4HI GCNGC 3 cut(s) 99, 102, 132
GluI GCNGC 3 cut(s) 99, 102, 132
Hin1II CATG 1 cut(s) 64
HinfI GANTC 1 cut(s) 122
Hpy166II GTNNAC 1 cut(s) 220
Hpy188I TCNGA 1 cut(s) 236
Hpy188III TCNNGA 2 cut(s) 55, 211
Hpy8I GTNNAC 1 cut(s) 220
HpyAV CCTTC 3 cut(s) 199, 298, 322
HpyCH4III ACNGT 1 cut(s) 160
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
Hsp92II CATG 1 cut(s) 64
Kzo9I GATC 1 cut(s) 175
LpnPI CCDG 4 cut(s) 68, 161, 192, 252
Lsp1109I GCAGC 1 cut(s) 85
MaeIII GTNAC 1 cut(s) 3
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MboII GAAGA 9 cut(s) 36, 205, 214, 260, 265, 272, 284, 301, 332
MflI RGATCY 1 cut(s) 175
MluCI AATT 1 cut(s) 10
MmeI TCCRAC 1 cut(s) 214
MnlI CCTC 4 cut(s) 277, 289, 301, 325
MseI TTAA 1 cut(s) 9
MspA1I CMGCKG 1 cut(s) 104
MvnI CGCG 1 cut(s) 131
MwoI GCNNNNNNNGC 1 cut(s) 95
NdeII GATC 1 cut(s) 175
NlaIII CATG 1 cut(s) 64
NlaIV GGNNCC 1 cut(s) 177
NmuCI GTSAC 1 cut(s) 3
PfeI GAWTC 1 cut(s) 122
PkrI GCNGC 3 cut(s) 100, 103, 133
PspN4I GGNNCC 1 cut(s) 177
PspPI GGNCC 3 cut(s) 52, 145, 236
PstNI CAGNNNCTG 2 cut(s) 154, 185
PsuI RGATCY 1 cut(s) 175
SaqAI TTAA 1 cut(s) 9
SatI GCNGC 3 cut(s) 99, 102, 132
Sau3AI GATC 1 cut(s) 175
Sau96I GGNCC 3 cut(s) 52, 145, 236
SetI ASST 3 cut(s) 100, 156, 210
SfcI CTRYAG 1 cut(s) 186
SgeI CNNG 8 cut(s) 67, 73, 142, 160, 191, 223, 251, 256
SinI GGWCC 3 cut(s) 52, 145, 236
Sse9I AATT 1 cut(s) 10
SsiI CCGC 2 cut(s) 102, 131
StyI CCWWGG 1 cut(s) 243
TaaI ACNGT 1 cut(s) 160
TaqI TCGA 1 cut(s) 35
TasI AATT 1 cut(s) 10
TauI GCSGC 2 cut(s) 104, 134
TfiI GAWTC 1 cut(s) 122
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TscAI CASTG 1 cut(s) 186
TseFI GTSAC 1 cut(s) 3
TseI GCWGC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 3
TspRI CASTG 1 cut(s) 186
VpaK11BI GGWCC 3 cut(s) 52, 145, 236
XmiI GTMKAC 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.