MD09G1066800.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0014143
Physical Location & Seq
Forward (+)
4548985 .. 4549993
1009 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1066800.v1.1.491

Sequence Viewer

Length: 369 bp
ATGGAAAACATAGCAGAAGTGCCTCCTATGAGGCCGACTCAGCCAGAGAAAACATTTTCCGAGTGCATAACGCCACCGCCTCCGCTTCAACACAAGGATGAAAATTCTCAAAACTCCGGCAACGATTTACGCAAAATCACTACGCCGGATCGCCTTAAGGTCCCCAAGGCATTTAAGTTCCCAGAAAGGTATACTAGCCCAACCGATATGATAATGTCCCCTGTAACACAAGGCCTTCTTGCCAGAAACAGAAAGGGTGGTGCCCTCTTGCCACCTAGCATAAATCTACCCAAACCTCCTCAAGATTCAGGAATTGAAGGTGTGGGATGTGGTCCAACTGCTGAATTAAAGTTTGGGTGCGATAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Spo12

Protein Analysis

123

Amino Acids

13.32

Weight (kDa)

7.7

Isoelectric Point (pI)

62.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014143)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G02120
fragaria_vesca FvH4_6g46850
malus_domestica MD09G1066800.v1.1 MD17G1059700.v1.1
prunus_persica Prupe.3G254900_v2.0.a1
pyrus_communis pycom111g05610 pycom17g05940
rosa_chinensis RchiOBHm_Chr2g0165841
rosa_laevigata RLG00000021561
rosa_multiflora Rmu_sc0008709.1_g000002
rosa_roxburghii Rroxscaffold_2G00085450
rosa_rugosa Rorug02G0518300
rosa_samantha Rh2AG583900 Rh2BG596000 Rh2CG566800 Rh2DG605800
rosa_wichuraiana Rw2G048700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 260
AccI GTMKAC 1 cut(s) 191
AciI CCGC 2 cut(s) 77, 83
AclWI GGATC 1 cut(s) 156
AcsI RAATTY 1 cut(s) 103
AflII CTTAAG 1 cut(s) 155
AgsI TTSAA 2 cut(s) 89, 317
AjuI GAANNNNNNNTTGG 2 cut(s) 336, 368
AlwI GGATC 1 cut(s) 156
AoxI GGCC 2 cut(s) 32, 232
ApoI RAATTY 1 cut(s) 103
AspS9I GGNCC 2 cut(s) 160, 332
AvaII GGWCC 2 cut(s) 160, 332
BaeGI GKGCMC 1 cut(s) 265
BanI GGYRCC 1 cut(s) 260
BfaI CTAG 2 cut(s) 195, 276
BfrI CTTAAG 1 cut(s) 155
Bme18I GGWCC 2 cut(s) 160, 332
BmgT120I GGNCC 2 cut(s) 160, 332
BmiI GGNNCC 2 cut(s) 162, 262
BplI GAGNNNNNCTC 2 cut(s) 22, 54
BpuEI CTTGAG 1 cut(s) 285
BsaJI CCNNGG 1 cut(s) 165
BseDI CCNNGG 1 cut(s) 165
BseGI GGATG 2 cut(s) 103, 332
BseMII CTCAG 1 cut(s) 53
BseRI GAGGAG 1 cut(s) 288
BseSI GKGCMC 1 cut(s) 265
BshFI GGCC 2 cut(s) 34, 234
BshNI GGYRCC 1 cut(s) 260
BsiSI CCGG 2 cut(s) 117, 146
BslFI GGGAC 2 cut(s) 146, 202
BsmFI GGGAC 2 cut(s) 146, 202
BsnI GGCC 2 cut(s) 34, 234
Bsp1286I GDGCHC 1 cut(s) 265
Bsp143I GATC 1 cut(s) 148
BspACI CCGC 2 cut(s) 77, 83
BspANI GGCC 2 cut(s) 34, 234
BspCNI CTCAG 1 cut(s) 52
BspLI GGNNCC 2 cut(s) 162, 262
BspPI GGATC 1 cut(s) 156
BspT107I GGYRCC 1 cut(s) 260
BspTI CTTAAG 1 cut(s) 155
BssECI CCNNGG 1 cut(s) 165
BssMI GATC 1 cut(s) 148
BssNAI GTATAC 1 cut(s) 192
BssT1I CCWWGG 1 cut(s) 165
Bst1107I GTATAC 1 cut(s) 192
BstAFI CTTAAG 1 cut(s) 155
BstDEI CTNAG 1 cut(s) 39
BstF5I GGATG 2 cut(s) 103, 332
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstMWI GCNNNNNNNGC 1 cut(s) 40
BstSLI GKGCMC 1 cut(s) 265
BstZ17I GTATAC 1 cut(s) 192
BsuRI GGCC 2 cut(s) 34, 234
BtsCI GGATG 2 cut(s) 103, 332
Cfr13I GGNCC 2 cut(s) 160, 332
CviJI RGCY 4 cut(s) 34, 43, 198, 234
CviKI_1 RGCY 4 cut(s) 34, 43, 198, 234
DdeI CTNAG 1 cut(s) 39
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
Eco130I CCWWGG 1 cut(s) 165
Eco147I AGGCCT 1 cut(s) 234
Eco47I GGWCC 2 cut(s) 160, 332
EcoO109I RGGNCCY 1 cut(s) 160
EcoT14I CCWWGG 1 cut(s) 165
ErhI CCWWGG 1 cut(s) 165
FaiI YATR 6 cut(s) 11, 29, 68, 192, 209, 281
FalI AAGNNNNNCTT 2 cut(s) 222, 254
FaqI GGGAC 2 cut(s) 146, 202
FblI GTMKAC 1 cut(s) 191
FokI GGATG 2 cut(s) 110, 339
FspBI CTAG 2 cut(s) 195, 276
HaeIII GGCC 2 cut(s) 34, 234
HapII CCGG 2 cut(s) 117, 146
HinfI GANTC 2 cut(s) 37, 305
HpaII CCGG 2 cut(s) 117, 146
Hpy166II GTNNAC 1 cut(s) 192
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 2 cut(s) 302, 309
Hpy8I GTNNAC 1 cut(s) 192
HpyAV CCTTC 2 cut(s) 245, 311
HpyCH4V TGCA 1 cut(s) 66
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
HpyF3I CTNAG 1 cut(s) 39
Kzo9I GATC 1 cut(s) 148
LpnPI CCDG 7 cut(s) 57, 130, 159, 195, 234, 256, 294
MaeI CTAG 2 cut(s) 195, 276
MaeIII GTNAC 1 cut(s) 223
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MhlI GDGCHC 1 cut(s) 265
MluCI AATT 4 cut(s) 103, 312, 344, 364
MlyI GAGTC 1 cut(s) 31
MmeI TCCRAC 1 cut(s) 359
MnlI CCTC 6 cut(s) 24, 33, 90, 275, 306, 309
MseI TTAA 3 cut(s) 156, 174, 347
MslI CAYNNNNRTG 1 cut(s) 96
MspCI CTTAAG 1 cut(s) 155
MspI CCGG 2 cut(s) 117, 146
MwoI GCNNNNNNNGC 1 cut(s) 40
NdeII GATC 1 cut(s) 148
NlaIV GGNNCC 2 cut(s) 162, 262
PceI AGGCCT 1 cut(s) 234
PfeI GAWTC 1 cut(s) 305
PleI GAGTC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 31
PpuMI RGGWCCY 1 cut(s) 160
Psp5II RGGWCCY 1 cut(s) 160
PspN4I GGNNCC 2 cut(s) 162, 262
PspPI GGNCC 2 cut(s) 160, 332
PspPPI RGGWCCY 1 cut(s) 160
RseI CAYNNNNRTG 1 cut(s) 96
SaqAI TTAA 3 cut(s) 156, 174, 347
Sau3AI GATC 1 cut(s) 148
Sau96I GGNCC 2 cut(s) 160, 332
SchI GAGTC 1 cut(s) 31
SduI GDGCHC 1 cut(s) 265
SetI ASST 5 cut(s) 162, 191, 277, 298, 322
SinI GGWCC 2 cut(s) 160, 332
SmiMI CAYNNNNRTG 1 cut(s) 96
SmlI CTYRAG 2 cut(s) 155, 300
SmoI CTYRAG 2 cut(s) 155, 300
Sse9I AATT 4 cut(s) 103, 312, 344, 364
SseBI AGGCCT 1 cut(s) 234
SsiI CCGC 2 cut(s) 77, 83
SspMI CTAG 2 cut(s) 195, 276
StuI AGGCCT 1 cut(s) 234
StyI CCWWGG 1 cut(s) 165
TasI AATT 4 cut(s) 103, 312, 344, 364
TfiI GAWTC 1 cut(s) 305
Tru1I TTAA 3 cut(s) 156, 174, 347
Tru9I TTAA 3 cut(s) 156, 174, 347
TspDTI ATGAA 1 cut(s) 114
Vha464I CTTAAG 1 cut(s) 155
VpaK11BI GGWCC 2 cut(s) 160, 332
XapI RAATTY 1 cut(s) 103
XmiI GTMKAC 1 cut(s) 191
XspI CTAG 2 cut(s) 195, 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.