MD10G1048100.v1.1

structural constituent of ribosome

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Forward (+)
6394107 .. 6395873
1767 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1048100.v1.1.491

Sequence Viewer

Length: 150 bp
ATGGTCATTCGACTTGTCTCATCTGCTGGCACTGGATTTTTCTACACCAAGAAGAAGCCTTTTAAGGTGAGGGAAAAGCTTGAAATCCGAAAATTCGACCCTGTTGTAAATCGTCATGTTCTGTTTACAGAGACAAAAGTGAAAGTTTGA

Protein Analysis

50

Amino Acids

5.77

Weight (kDa)

10.51

Isoelectric Point (pI)

25.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L33 PF00471 3 - 46 3.9e-12 Ribosomal protein L33
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015174)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 92
AgsI TTSAA 1 cut(s) 83
AluBI AGCT 1 cut(s) 79
AluI AGCT 1 cut(s) 79
Alw26I GTCTC 2 cut(s) 22, 125
ApoI RAATTY 1 cut(s) 92
AsuHPI GGTGA 1 cut(s) 79
BcoDI GTCTC 2 cut(s) 22, 125
Bse1I ACTGG 1 cut(s) 37
BseNI ACTGG 1 cut(s) 37
BsmAI GTCTC 2 cut(s) 22, 125
BsrI ACTGG 1 cut(s) 37
BstC8I GCNNGC 1 cut(s) 28
BstMAI GTCTC 2 cut(s) 22, 125
BtsIMutI CAGTG 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 28
CviAII CATG 1 cut(s) 116
CviJI RGCY 2 cut(s) 58, 79
CviKI_1 RGCY 2 cut(s) 58, 79
FaeI CATG 1 cut(s) 119
FaiI YATR 1 cut(s) 117
FatI CATG 1 cut(s) 115
Hin1II CATG 1 cut(s) 119
HindIII AAGCTT 1 cut(s) 77
HphI GGTGA 1 cut(s) 79
Hpy166II GTNNAC 1 cut(s) 126
Hpy188I TCNGA 1 cut(s) 89
Hpy8I GTNNAC 1 cut(s) 126
Hsp92II CATG 1 cut(s) 119
LpnPI CCDG 3 cut(s) 12, 18, 114
MboII GAAGA 1 cut(s) 64
MluCI AATT 1 cut(s) 92
MnlI CCTC 1 cut(s) 63
MseI TTAA 1 cut(s) 63
NlaIII CATG 1 cut(s) 119
SaqAI TTAA 1 cut(s) 63
SetI ASST 2 cut(s) 69, 81
SgeI CNNG 7 cut(s) 26, 39, 45, 61, 92, 113, 128
Sse9I AATT 1 cut(s) 92
TaqI TCGA 2 cut(s) 10, 96
TasI AATT 1 cut(s) 92
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TscAI CASTG 1 cut(s) 37
TspRI CASTG 1 cut(s) 37
XapI RAATTY 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.