Rw7G027220

structural constituent of ribosome

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Reverse (-)
35059494 .. 35059676
183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G027220.1

Sequence Viewer

Length: 183 bp
ATGGGTGACAAGAAGAAGAAGAAGGCTACTATGCTCATCCGACTTGTGTCATCTGCTAGGACTGGATATTTCTATGTCACCAAGAAGCCGTCCGGGATGACAGAAAAACTTGAGTTGCGAAAATATGATCCTCGGGTAAAACTTCATGTTCTATTTACTGAGGCCAAATTGAAAATTAAATAA

Protein Analysis

60

Amino Acids

7.0

Weight (kDa)

10.33

Isoelectric Point (pI)

17.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L33 PF00471 12 - 56 2.7e-12 Ribosomal protein L33
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015174)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 122
AgsI TTSAA 1 cut(s) 172
AlwI GGATC 1 cut(s) 122
Ama87I CYCGRG 1 cut(s) 132
AoxI GGCC 1 cut(s) 162
AsuC2I CCSGG 1 cut(s) 94
AsuHPI GGTGA 2 cut(s) 17, 70
AvaI CYCGRG 1 cut(s) 132
BceAI ACGGC 1 cut(s) 73
BcnI CCSGG 1 cut(s) 94
BfaI CTAG 1 cut(s) 57
Bme1390I CCNGG 1 cut(s) 94
BmeT110I CYCGRG 1 cut(s) 132
BmrFI CCNGG 1 cut(s) 94
BoxI GACNNNNGTC 1 cut(s) 46
BpuEI CTTGAG 1 cut(s) 131
BpuMI CCSGG 1 cut(s) 94
BsaJI CCNNGG 1 cut(s) 131
Bse1I ACTGG 1 cut(s) 67
BseDI CCNNGG 1 cut(s) 131
BseGI GGATG 2 cut(s) 36, 102
BseMII CTCAG 1 cut(s) 150
BseNI ACTGG 1 cut(s) 67
BshFI GGCC 1 cut(s) 164
BsiHKCI CYCGRG 1 cut(s) 132
BsiSI CCGG 1 cut(s) 93
BsnI GGCC 1 cut(s) 164
BsoBI CYCGRG 1 cut(s) 132
Bsp143I GATC 1 cut(s) 127
BspANI GGCC 1 cut(s) 164
BspCNI CTCAG 1 cut(s) 151
BspPI GGATC 1 cut(s) 122
BsrI ACTGG 1 cut(s) 67
BssECI CCNNGG 1 cut(s) 131
BssMI GATC 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 159
BstF5I GGATG 2 cut(s) 36, 102
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstPAI GACNNNNGTC 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 92
BsuRI GGCC 1 cut(s) 164
BtsCI GGATG 2 cut(s) 36, 102
CviAII CATG 1 cut(s) 146
CviJI RGCY 3 cut(s) 26, 88, 164
CviKI_1 RGCY 3 cut(s) 26, 88, 164
DdeI CTNAG 1 cut(s) 159
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
Eco88I CYCGRG 1 cut(s) 132
FaeI CATG 1 cut(s) 149
FaiI YATR 4 cut(s) 32, 75, 126, 147
FatI CATG 1 cut(s) 145
FokI GGATG 2 cut(s) 23, 109
FspBI CTAG 1 cut(s) 57
HaeIII GGCC 1 cut(s) 164
HapII CCGG 1 cut(s) 93
Hin1II CATG 1 cut(s) 149
HpaII CCGG 1 cut(s) 93
HphI GGTGA 2 cut(s) 17, 70
Hpy188I TCNGA 1 cut(s) 41
HpyAV CCTTC 1 cut(s) 16
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 1 cut(s) 149
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 2 cut(s) 48, 106
MaeI CTAG 1 cut(s) 57
MaeIII GTNAC 2 cut(s) 5, 76
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 3 cut(s) 25, 28, 31
MluCI AATT 2 cut(s) 167, 174
MmeI TCCRAC 1 cut(s) 64
MnlI CCTC 2 cut(s) 141, 154
MseI TTAA 1 cut(s) 177
MspI CCGG 1 cut(s) 93
MspR9I CCNGG 1 cut(s) 94
NciI CCSGG 1 cut(s) 94
NdeII GATC 1 cut(s) 127
NlaIII CATG 1 cut(s) 149
NmuCI GTSAC 2 cut(s) 5, 76
PfoI TCCNGGA 1 cut(s) 92
PshAI GACNNNNGTC 1 cut(s) 46
SaqAI TTAA 1 cut(s) 177
Sau3AI GATC 1 cut(s) 127
ScrFI CCNGG 1 cut(s) 94
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 2 cut(s) 167, 174
SspMI CTAG 1 cut(s) 57
StyD4I CCNGG 1 cut(s) 92
TasI AATT 2 cut(s) 167, 174
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TseFI GTSAC 2 cut(s) 5, 76
Tsp45I GTSAC 2 cut(s) 5, 76
TspDTI ATGAA 1 cut(s) 134
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.