MD11G1158400.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
15394075 .. 15400677
6603 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1158400.v1.1.491

Sequence Viewer

Length: 273 bp
ATGCAAACATTCAAGAAATTCAAGAAAATCTGCCTCCTGCATCCTTTCCTTCTATTACTCAATTTTTGGTTAACAACTTCAATTCCTCAAAATGCTTCAACAATCTTTTGTCACAAACTGAAAACTCAAACGCGATTTTCGAAACCAAATTCAACCGCGTTTTCTCCGCTAAACCACATTTTCCTGTGCAAATCTCGAAAACTATACCATTGTAATAGAGCCTCTATTAATCTGTTCCCAATTTCCTATACTAACTACCGATGTAAAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.63

Weight (kDa)

10.23

Isoelectric Point (pI)

24.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013423)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 133, 158
AciI CCGC 2 cut(s) 156, 167
AcsI RAATTY 2 cut(s) 17, 148
AgsI TTSAA 5 cut(s) 13, 22, 81, 99, 153
ApoI RAATTY 2 cut(s) 17, 148
AseI ATTAAT 1 cut(s) 228
AsuII TTCGAA 1 cut(s) 140
BmsI GCATC 1 cut(s) 49
Bpu14I TTCGAA 1 cut(s) 140
BseGI GGATG 1 cut(s) 40
Bsh1236I CGCG 2 cut(s) 133, 158
Bsp119I TTCGAA 1 cut(s) 140
BspACI CCGC 2 cut(s) 156, 167
BspFNI CGCG 2 cut(s) 133, 158
BspT104I TTCGAA 1 cut(s) 140
BstBI TTCGAA 1 cut(s) 140
BstF5I GGATG 1 cut(s) 40
BstFNI CGCG 2 cut(s) 133, 158
BstUI CGCG 2 cut(s) 133, 158
BtsCI GGATG 1 cut(s) 40
CviJI RGCY 1 cut(s) 221
CviKI_1 RGCY 1 cut(s) 221
FaiI YATR 2 cut(s) 205, 249
FokI GGATG 1 cut(s) 27
HincII GTYRAC 1 cut(s) 72
HindII GTYRAC 1 cut(s) 72
HpaI GTTAAC 1 cut(s) 72
Hpy166II GTNNAC 1 cut(s) 72
Hpy188III TCNNGA 3 cut(s) 13, 22, 195
Hpy8I GTNNAC 1 cut(s) 72
HpyAV CCTTC 1 cut(s) 59
HpyCH4V TGCA 3 cut(s) 4, 40, 189
KspAI GTTAAC 1 cut(s) 72
LpnPI CCDG 2 cut(s) 50, 197
LweI GCATC 1 cut(s) 49
MaeIII GTNAC 1 cut(s) 110
MluCI AATT 5 cut(s) 17, 61, 81, 148, 240
MnlI CCTC 3 cut(s) 44, 96, 232
MseI TTAA 2 cut(s) 71, 228
MvnI CGCG 2 cut(s) 133, 158
NmuCI GTSAC 1 cut(s) 110
NspV TTCGAA 1 cut(s) 140
PcsI WCGNNNNNNNCGW 1 cut(s) 137
PshBI ATTAAT 1 cut(s) 228
SaqAI TTAA 2 cut(s) 71, 228
SfaNI GCATC 1 cut(s) 49
SfuI TTCGAA 1 cut(s) 140
SgeI CNNG 7 cut(s) 25, 34, 49, 144, 169, 196, 207
Sse9I AATT 5 cut(s) 17, 61, 81, 148, 240
SsiI CCGC 2 cut(s) 156, 167
TaqI TCGA 2 cut(s) 140, 196
TasI AATT 5 cut(s) 17, 61, 81, 148, 240
Tru1I TTAA 2 cut(s) 71, 228
Tru9I TTAA 2 cut(s) 71, 228
TseFI GTSAC 1 cut(s) 110
Tsp45I GTSAC 1 cut(s) 110
VspI ATTAAT 1 cut(s) 228
XapI RAATTY 2 cut(s) 17, 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.